Fourthly, an “Asian Center

for Corporate Social Responsibility at AIT” (ACCSR) has been recently launched, which is a joint venture partnership between the AIT and CSR Asia. Its Crenigacestat manufacturer mission is to advance the development and implementation of effective sustainability solutions both for and by business, and to facilitate development of the supportive framework conditions for corporate social responsibility and sustainable development. The ACCSR will provide a platform for dialog and innovation for the representatives of the private sector in seeking creative solutions for the challenging issues of sustainable development. The pathway to enhancing sustainable development, AZD1480 manufacturer considering not only the three pillars of economy, environment, and society, but a cross-cutting theme, namely, the human dimension (self), is not easy. The formulation and implementation of sustainable development policies at international, national, and local levels require a new breed of: Policymakers and planners, who can prepare and execute sustainable development policies; and Technical experts working in various sectors, who can develop and disseminate environmentally and socio-economically sustainable this website technologies. During the last few years, it is becoming increasingly important for institutions of higher learning

to start considering sustainable development efforts and initiatives from a significantly longer term perspective or horizon considering sustainable development in a more comprehensive manner. The ADB’s long-term strategy looks at a 2020 period, while the OECD projects 2030 scenarios as to how higher education could evolve, with the aim of informing and facilitating strategic change to be made by government decision makers and other key stakeholders in higher education. While traditionally it may have been the role of a university to take a didactic role

in development, telling society Venetoclax cell line what is right and what is wrong, and providing science and technology based upon research done within the ivory tower, that role is changing. Society, with its ever increasing number of knowledge centers, has begun to talk back. Therefore, higher education needs to undergo, and is undergoing, fundamental changes. More and more, universities are becoming neutral platforms on which to build collaboration between the public and private sectors and between those who conduct research and those who use it. Universities are becoming the facilitators of dialog and technology transfer. Therefore, we need to forge forward-looking curricula that tear down the walls of traditional disciplines. Institutions of higher learning should be able to train graduates who could address these emerging issues.

Recent works in the field of microbial ecology that take advantage of non-cultivating methods are elucidating the gut

colonization process. Here, we have found that DAEC P505-15 strains possessing Afa/Dr genes may reflect some principles that apply to the microbiota in general. First, as microbiota composition is different in children and adults, we found that DAEC from children and from adults represent two different populations, with distinct profiles regarding the characteristics studied in this work. Second, as microbiota seems to be more diversified in control subjects than in diarrhea patients [72], DAEC strains isolated from asymptomatic controls present greater diversity of genes related to virulence. Quiroga et Silmitasertib clinical trial al.[73] demonstrated that strains of E. coli belonging to four different diarrheagenic categories – including DAEC and EPEC – can be found colonizing infants in the first months of life. Here, we refined the analysis of DAEC strains and found that potentially diarrheagenic

strains can be found as part of gut microbiota in children. We also demonstrated that many DAEC strains possessing Afa/Dr genes belong to serogroups associated with EPEC, reflecting perhaps an evolutionary relationship. DAEC strains as etiological agents of diarrhea are still a matter of 3MA controversy. We found that DAEC strains possessing Afa/Dr genes from children and adults possibly possess Verteporfin distinct virulent mechanisms. DAEC strains from children apparently have greater ability of colonizing the gastrointestinal tract, which may contribute to the effective action of a toxin, such as SAT. We also demonstrated for the first time, to the authors’ knowledge, that curli can play a role in pathogenesis of DAEC strains isolated from adults. Further studies are warranted to conclusively demonstrate this involvement. Conclusions DAEC strains possessing Afa/Dr genes isolated from children and adults have shown very distinct profiles regarding the distribution of the characteristics analyzed in this work. Strains from children are more diverse than strains from adults in relation to

the studied characteristics. Most characteristics were more frequent in strains from asymptomatic children. In contrast, virulence factors were less frequent in strains from adults, which seem to form a more homogeneous group. Characteristics potentially associated to virulence are distinct in DAEC strains from adults and children. The results confirm the importance of SAT in diarrhea caused by DAEC in children and suggest that its action may be enhanced as a result of their efficiency in colonization. Moreover, curli is a potential virulence factor for DAEC strains that cause diarrhea in adults. Together, these results indicate that DAEC strains possessing Afa/Dr genes isolated from children and adults represent two different bacterial populations.

faecalis and E. faecium, using the MLST database and the “”working backwards”" mode of the Minimum SNPs program. SNP validation by sequencing of MLST housekeeping genes E. faecalis and E. faecium isolates representing each possible SNP were used to validate the polymorphism present at each position. Sequencing was performed to confirm the SNP profiles using MLST sequencing primers listed at http://​efaecalis.​mlst.​net/​misc/​info.​asp and http://​efaecium.​mlst.​net/​misc/​info.​asp.

PCR products were prepared for sequencing using the high pure PCR product purification kit (Roche, Indianapolis, USA) according to manufacturer’s instructions. Between 18 -30 ng DNA template was mixed with the relevant Selleck VE822 find more sequencing primer at a final concentration of 9.6 pmol in

a 12 μl reaction containing the Big Dye terminator mix (Australian Genome Research Facility – AGRF). Sequencing reactions were performed using a protocol of 96°C for 1 min, 96°C for 10 s, 50°C for 5 s and 60°C for 4 min on the AB3730XL platform. Sequencing data were analyzed using Chromas (version 1.43, Technelysium, Tewantin, Australia) and Vector NTI (version 11, Invitrogen, Australia) software programs. Real-Time PCR for the detection of antibiotic resistance Primer design Real-Time PCR primers for genes encoding vancomycin (vanA, vanB), tetracycline (tet(L), tet(M), tet(S)), ciprofloxacin (gyrA), ampicillin (pbp 5) and gentamicin (aac(6′)-aph(2′)) resistance were designed using the

Primer Express 2.0 primer design software program (Applied BioSystems) (Table 2). Primers were synthesised by Sigma-Aldrich, Castle Hill, New South Wales, Australia. Table 2 Oligonucleotide primers for Real-Time PCR detection of genes encoding for resistance to vancomycin (vanA, vanB, vanC1, vanC2), tetracycline (tet(L), tet(M), tet(S)), ciprofloxacin (gyrA), ampicillin (pbp5) and gentamicin (aac(6′)-aph(2′)) Erastin in vivo Target gene Primer name Primer sequence (5′ to3′) Positive control van A vanAFa TGTGCGGTATTGGGAAACAG ATCC 51559   vanARb GATTCCGTACTGCAGCCTGATT   van B vanBF TCTGCTTGTCATGAAAGAAAGAGAA ATCC 700802   vanBR GCATTTGCCATGCAAAACC   tet(L) tetLF GGGTAAAGCATTTGGTCTTATTGG RBH200523   tetLR ATCGCTGGACCGACTCCTT   tet(M) tetMF GCAGAATATACCATTCACATCGAAGT RBH200535   tetMR AAACCAATGGAAGCCCAGAA   tet(S) tetSF selleck chemicals llc CCATTGATATCGAAGTACCTCCAA RBH200535   tetSR AGGAAGTGGTGTTACAGATAAACCAA   gyr A gyrAF CGGATGAACGAATTGGGTGTGA ATCC 51559   gyrAR AATTTTACTCATACGTGCTT   pbp 5 pbp5F GTTCTGATCGAACATGAAGTTCAAA ATCC 51559   pbp5R TGTGCCTTCGGATCGATTG   aac(6′)-aph(2′) acc-aphF TCCTTACTTAATGACCGATGTACTCT ATCC 700802   acc-aphR TCTTCGCTTTCGCCACTTTGA   Fa forward primer, Rb reverse primer Real-Time PCR Each reaction contained 2 μl of DNA which was added to 18 μl of reaction master mix containing 10 μl of 2 × SYBRGreen® PCR Mastermix (Invitrogen, Australia) and 0.25 μl of reverse and forward primers (20 μM stock, final concentration 0.5 μM).

The phoCDET operon, codes for a high affinity phosphate transport system [44]. A phoB dependent control of phoCDET could be observed in S. meliloti [15] and in E. coli it could be shown that phoB is involved in the acid shock response [45]. Cluster F is almost exclusively composed of genes playing a role in chemotaxis and motility Cluster F consists of genes whose expression was continuously lowered during the time course experiment (Fig. 2F). It mainly comprises genes (10 of 22) belonging to chemotaxis and flagellar biosynthesis (flgB,

flgG, flgL, flgF, flgC, flgE, fliE, flbT, motA, mcpU). Bortezomib research buy This phenomenon will be discussed in more detail later. Another gene in cluster F was lppB coding for a lipoprotein, which is a major outer membrane component was grouped in cluster F. A similar expression profile as those of the flagellar biosynthesis and chemotaxis genes confirms a possible co-regulation as was observed

in Salmonella enterica [46]. Cluster G consists of several genes involved in nitrogen uptake and utilization Cluster G consists of genes whose expression was transiently lowered between 8 and 18 minutes following Selleckchem CA-4948 the pH shift and afterwards returned nearly to the ground state (Fig. 2G). The genes nirB, nirD and narB were distributed to this cluster and are coding for nitrite and nitrate reductases forming ammonia from nitrate. A homologue of narB was found to be regulated by the low pH and microaerobiosis I BET 762 regulator ActR in S. medicae. A gene coding for an element of a nitrate import system (nrtB) could also be found in this cluster, while the remaining two elements of this system encoded by nrtA and nrtC were not included

in the analysis because their expression values were below the threshold for filtering. Additionally, genes coding for an ABC Uroporphyrinogen III synthase transport system (smb21707, smb20602, smb20603, smb20604 and smb20605) sharing homologies with amino acid and urea/short chain amide transport systems are present in cluster G. In addition to this transport system genes (smb20141, smb20142) of an ABC transport system homologous to the Dpp system from E. coli were also grouped in this cluster. This system is known for the import of dipeptides to provide the cell with essential amino acids, nitrogen and energy [47]. Cluster H is formed by genes with distinct biological functions and a high variation in their expression levels Cluster H consists of 13 genes that were transiently lower expressed on the very beginning of the time course (Fig. 2H). The proposed encoded functions of the genes in this cluster were found to be very diverse. A secreted peroxidase gene (sma1944) [48], a flagellar biosynthesis gene (fliP), a chemotaxis sensory gene (mcpW), a nodulation gene (nodP1) and several hypothetical protein encoding genes were identified to be in cluster H.

13 nm for 150°C, 6.69 nm for 200°C, 8.83 nm for 250°C, 15.85 nm for 300°C, and 23.62 nm for 350°C. Large dielectric relaxation is observed for the sample of 6.13 nm (diamond symbol). The minimum k value at 1 MHz is one third of the maximum value at 100 Hz. When the deposition temperature increases, the dielectric relaxation is even worse for the sample of 6.69 nm (square symbol). The k value variation is more significant across all the frequency range. In addition, the most severe dielectric relaxation is measured for the sample of 8.83 nm (star symbol). The worst situation selleck screening library is that the k value calculated at 1 MHz is

only 10% of the k value below 100 Hz. Also, from the preceding figure, the normalized dielectric constants are the smallest for all of the frequencies, which means that the dielectric constant makes the most significant value drop within the region of different frequencies for the sample of 8.83 nm. The sample of 15.85 nm (triangle symbol) has significant improvement on dielectric relaxation. The k value variation from 100 Hz to 1 MHz is narrowed accordingly. The sample of 23.62 nm (round symbol) shows a more stable frequency

Rapamycin mw response. As a consequence, it is not always true for the inference we made earlier: the smaller grain size has a larger dielectric relaxation (the sample of 8.83 nm has the worst dielectric relaxation, but 8.83 nm is not the smallest grain size value among all Ulixertinib order the samples). Nevertheless, if a comparison is made between samples of 6.13 nm (the smallest)

and 23.62 nm (the largest), the larger-grain-size sample is shown to have better dielectric relaxation performance. It is also consistent with our previous experimental results triclocarban [9]. However, the trade-off for the 23.62-nm sample is that the dielectric constant is smaller than the 6.13-nm sample. Especially in terms of the dielectric constant, on 100 Hz, the dielectric constant for the 23.62-nm sample is only half of the value for the 6.13-nm sample. Moreover, in 1 MHz, the dielectric constant for the 23.62-nm sample is two thirds that of the value for the 6.13-nm sample. Thus, the 23.62-nm samples perform best at the expense of the dielectric constant. Similarly, the effect of grain size on dielectric relaxation is found on the Nd-doped Pb1-3x/2Nd x (Zr0.65Ti0.35)O3 composition (PNZT) [19], where x = 0.00, 0.01, 0.03, 0.05, 0.07, and 0.09, respectively. Lead-based perovskite ferroelectric ceramics are widely applied in multilayer capacitors, microelectromechanical systems, and integrated devices such as ferroelectric memories, infrared sensors, microactuators, etc. Moreover, lead zirconium titanate is one of the best lead-based materials that have been studied extensively recently. The PNZT samples were fabricated according to the A-site vacancy formula and were prepared by the traditional mixed-oxide solid-state reaction method. The grain size decreases as Nd doping (x) increases.

Langmuir 1999, 15:2125–2129.CrossRef 46. Pereira GG,

Williams DRM: Equilibrium properties of diblock copolymer thin films on a heterogeneous, striped surface. Macromolecules 1998, 31:5904–5915.CrossRef 47. Pereira GG, Williams DRM: Diblock copolymer thin films on heterogeneous striped surfaces: commensurate, incommensurate and inverted lamellae. Phys Rev Lett 1998, 80:2849–2852.CrossRef 48. Ludwigs S, Schmidt K, buy AZ 628 Stafford CM, Amis EJ, Fasolka MJ, Karim A, Magerle R, Krausch find more G: Combinatorial mapping of the phase behavior of ABC triblock terpolymers in thin films: experiments. Macromolecules 2005, 38:1850–1858.CrossRef 49. Wolff M, Scholz U, Hock R, Magerl A, Leiner V, Zabel H: Crystallization of micelles at chemically terminated interfaces. Phys Rev Lett 2004, 92:255501.CrossRef 50. Park S, Lee DH, Xu J, Kim B, Hong SW, Jeong U, Xu T, Russell TP: Macroscopic 10-terabit-per-square- inch arrays from block copolymers with lateral order. Science 2009, 323:1030–1033.CrossRef 51. Luzinov I, Minko S, Tsukruk VV: Adaptive and responsive surfaces through controlled reorganization of interfacial polymer layers. Prog Polym Sci 2004, 29:635–698.CrossRef 52. Peters RD, Yang XM, Nealey PF: Morphology of thin films of diblock copolymers on surfaces micropatterned with regions of different interfacial energy.

Macromolecules 2002, 35:1822–1834.CrossRef 53. Walton selleck chemicals llc DG, Soo PP, Mayes AM, Allgor SJS, Fujii JT, Griffith LG, Ankner JF, Kaiser H, Johansson J, Smith GD, Barker JG, Satija SK: Creation of stable poly(ethylene oxide) surfaces on poly(methyl methacrylate) using blends of branched and linear polymers. Macromolecules 1997, 30:6947–6956.CrossRef 54. Ryu DY, Shin K, Drockenmuller E, Hawker CJ, Russell TP: A generalized approach to the modification of solid surfaces. Science 2005, 308:236–239.CrossRef 55. Pickett GT, Balazs AC: Equilibrium behavior of confined Orotidine 5′-phosphate decarboxylase triblock copolymer films. Macromol Theory Simul 1998, 7:249–255.CrossRef 56. Chen HY, Fredrickson GH: Morphologies of ABC triblock copolymer thin films. J Chem Phys 2002, 116:1137–1146. 57. Ludwigs S, Krausch G, Magerle

R, Zvelindovsky AV, Sevink GJA: Phase behavior of ABC triblock terpolymers in thin films: mesoseale simulations. Macromolecules 2005, 38:1859–1867.CrossRef 58. Knoll A, Lyakhova KS, Horvat A, Krausch G, Sevink GJA, Zvelindovsky AV, Magerle R: Direct imaging and mesoscale modelling of phase transitions in a nanostructured fluid. Nat Mater 2004, 3:886–890. 59. Feng J, Ruckenstein E: Monte Carlo simulation of triblock copolymer thin films. Polymer 2002, 43:5775–5790.CrossRef 60. Ludwigs S, Boker A, Voronov A, Rehse N, Magerle R, Krausch G: Self-assembly of functional nanostructures from ABC triblock copolymers. Nat Mater 2003, 2:744–747. 61. Ren CL, Chen K, Ma YQ: Ordering mechanism of asymmetric diblock copolymers confined between polymer-grafted surfaces. J Chem Phys 2005, 122:154904. 62.

22. Nieman DC, Williams AS, Shanely RA, Jin F, McAnulty SR, Triplett NT, Austin MD, Henson DA: Quercetin’s influence on exercise performance and muscle mitochondrial biogenesis. Med Sci Sports Exerc 2010, 42:338–345.PubMedCrossRef 23. Campbell BI, Bounty PML, Roberts M: The ergogenic potential of arginine. J Int Soc Sports Nutr 2004, 1:35–38.PubMedCentralPubMedCrossRef 24. Doutreleau S, Rouyer O, Di Marco P, Lonsdorfer E, Richard R, Piquard F, Geny B: L-arginine supplementation improves exercise capacity after a heart transplant. Am J Clin Everolimus order Nutr 2010, 91:1261–1267.PubMedCrossRef 25. Bailey SJ, Winyard PG, Vanhatalo A, Blackwell JR, DiMenna FJ, Wilkerson DP, Jones AM: Acute L-arginine supplementation

reduces the O 2 cost of moderate-intensity exercise and enhances high-intensity exercise tolerance. J Appl Physiol 2010, 109:1394–1403.PubMedCrossRef 26. Chen S, Kim W, Henning SM, Carpenter CL, Li Z: Arginine and antioxidant supplement on performance in elderly male cyclists: a randomized controlled trial. J Int Soc Sports Nutr 2010, 7:13.PubMedCentralPubMedCrossRef 27. Gonçalves LC, Bessa A, Freitas-Dias

R, Luzes R, Werneck-de-Castro JP, Bassini A, Cameron LC: A sportomics strategy to analyze the ability of arginine to modulate both ammonia and lymphocyte levels in blood after high-intensity exercise. J Int Soc Sports Nutr 2012, 9:30.PubMedCentralPubMedCrossRef 28. Meyer T, Georg T, Becker C, Kindermann W: Reliability of gas exchange measurements from two different spiroergometry systems. Int J Sports Med 2001, 22:593–597.PubMedCrossRef 29. Schulz

H, Helle S, Heck H: The validity of the telemetric system Gamma-secretase inhibitor CORTEX X1 in the ventilatory and gas exchange measurement during exercise. Int J Sports Med 1997, 18:454–457.PubMedCrossRef 30. Ying X, Jun-bo W, Shao-fang Y: Study on effect of nut rich in monounsaturated fatty acid on serum lipids in hyperlipidemia patients. Chin Publ Health 2002, 18:931–932. 31. Leonard SW, Paterson E, Atkinson JK, Ramakrishnan R, Cross CE, Traber MG: Studies in humans using deuterium-labeled Dehydratase α- and γ-tocopherol demonstrate faster plasma g-tocopherol disappearance and greater g-metabolite production. Free Radic Biol Med 2005, 38:857–866.PubMedCrossRef 32. Graefe EU, Wittig J, Mueller S, Riethling AK, Uehleke B, Drewelow B, Pforte H, Jacobasch G, Derendorf H, Beit M: Pharmacokinetics and bioavailability of quercetin glycosides in humans. J Clin Pharmacol 2001, 41:492–499.PubMedCrossRef 33. Lamson DW, Brignall MS: see more Antioxidants and cancer, part 3: Quercetin. Altern Med Rev 2000, 5:196–208.PubMed 34. Manach C, Williamson G, Morand C, Scalbert A, Rémésy C: Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am J Clin Nutr 2005,81(suppl):230S-242S.PubMed 35. Böger RH, Bode-Böger SM: The clinical pharmacology of L-arginine. Annu Rev Pharmacol Toxicol 2001, 41:79–99.PubMedCrossRef 36.

IGS type I was found RAD001 concentration in the nodules of only Omondaw, type II in both Omondaw and Bechuana white, type III in all the genotypes except Omondaw and Bechuana white, type IV in IT82D-889 only, type V in all genotypes except Omondaw, type VI in Glenda, Brown eye and Fahari, type VII in Omondaw, IT82D-889, Bechuana white and

Glenda, type VIII in all the genotypes except Glenda, types IX, X, XI and XII in only Glenda, type XIII in only Fahari and Apagbaala, type XIV in only Apagbaala, types XV, XVI and XVII in only Fahari, and type XVIII in only Apagbaala (Table 4). Table 4 Percent nodule occupancy by different IGS types

in 9 cowpea genotypes grown in Ghana, Botswana and South Africa   Percent GKT137831 nodule occupancy per cowpea variety IGS Type Omondaw IT82D-889 Bechuana white Glenda ITH98-46 Brown eye Mamlaka Fahari Apagbaala I 33.3 0 0 0 0 0 0 0 0 II 44.4 0 15.8 0 0 0 0 0 0 III 0 28 0 16 68.2 83.3 15.8 13.3 28.6 IV 0 11 0 0 0 0 0 0 0 V 0 25 57.9 36 26.3 16.7 5.3 6.7 28.6 VI 0 0 0 8 0 0 0 6.7 0 VII 11.1 4 10.5 4 0 0 0 0 0 VIII 11.2 32 15.8 0 5.5 0 78.9 46.6 16.6 IX 0 0 0 16 0 0 0 0 0 X 0 0 0 4 0 0 0 0 0 XI 0 0 0 4 0 0 0 0 0 XII 0 0 0 4 0 0 0 0 0 XIII 0 0 0 0 0 0 0 13.3 16.6 XIV 0 0 0 0 0 0 0 0 4.8 XV 0 0 0 0 0 0 0 6.7 0 XVI 0 0 0 0 0 0 0 6.7 0 XVII 0 0 0 8 0 0 0 0 0 XVIII 0 0 0 0 0 0 0 0 4.8 Values (Mean ± SE)

with dissimilar letters in a column are statistically significant at p ≤ 0.001 (***); p ≤ 0.01 (**) The per-country data for nodule occupancy by each strain (or IGS type) are shown in Table 5. IGS types I, IV, IX, X, XI, XIII, XIV, XVI, XVII and XVIII were only found in the root nodules of cowpea plants Unoprostone grown at Taung, South Africa (but not in those from Ghana and Botswana), while XV and XIX were exclusively found in nodules from Glenvalley in Botswana, and IGS type XII was unique to nodules from Ghana. of IGS types selected for gene sequencing Percent nodule occupancy per country     South Africa Botswana Ghana I 5 100 0 0 II 8 25 0 75 III 116 71.4 18.6 0 IV 22 100 0 0 V 68 78.6 9.4 12 VI 103 85.7 14.3 0 VII 27 60 0 40 VIII 36 94.2 0 5.8 IX 104 100 0 0 X 115 100 0 0 XI 117 100 0 0 XII 201 0 0 100 XIII 91 100 0 0 XIV 106 100 0 0 XV 7/116 0 100 0 XVI 146 100 0 0 XVII 150 100 0 0 XVIII 153 100 0 0 Strain IGS type diversity from PCR-RFLP analysis When DNA from each nodule was amplified with the two primers, FGPL 132-38 and FGPS 1490-72, a PCR https://www.selleckchem.com/products/sgc-cbp30.html product of about 900 bp was found that corresponded to the size of 16S-23S IGS region.

5 g/l arabinose boosted the lycopene concentration to 32 mg/g CDW [31]. The very good lycopene concentration obtained by C. glutamicum after engineering only the final three enzymatic steps of lycopene synthesis can likely be further enhanced by additional metabolic engineering of (a) find more IPP synthesis using the endogenous MEP pathway and/or the heterologous MVA pathway, (b) genome-based or computational approaches to identify target genes in the central metabolism or its regulation and (c) by process engineering using e.g. fed-batch protocols. Thus, C. glutamicum may serve as a suitable production host for lycopene and related carotenoids. In addition, C.

glutamicum is a natural producer of the relatively rare group of C50 carotenoids that feature strong antioxidative properties due to the multiple conjugated double bonds and the hydroxyl group [32–34]. The pharmaceutical potential of these C50 carotenoids is not yet well studied [35]. It is imaginable that decaprenoxanthin, its direct precursor flavuxanthin or the C50 carotenoid of Micrococcus luteus, sarcinaxanthin, could be of commercial interest. Notably, genes of C. glutamicum and of M. luteus have been used to engineer E. coli for the production of sarcinaxanthin [20]. Thus, the IGF-1R inhibitor product range of structurally diverse C50 carotenoids could be accessible by engineered hosts including C. glutamicum. Conclusion The genes of the carotenoid

Lazertinib chemical structure gene cluster of C. glutamicum ATCC 13032 crtE-cg0722-crtBIY e Y f Eb are co-transcribed and encode the enzymes

involved in the biosynthesis of the C50 carotenoid decaprenoxanthin. An alternative, functionally active phytoene synthase is encoded in the crtB2/crtI2-1/crtI2-2 operon leading to a certain degree of redundancy in carotenoid synthesis in C. glutamicum. The potential of C. glutamicum as production host for terpenoids in general was demonstrated by considerable lycopene production after engineering the terminal reactions leading to lycopene. Methods Bacterial strains, media and growth conditions The strains and plasmids used in this work are listed in Additional file 3: Table S2. C. glutamicum ATCC 13032 was used as wild type (WT). Precultivation of C. MycoClean Mycoplasma Removal Kit glutamicum strains was performed in BHI or LB medium. For cultivation in CGXII medium [36] precultivated cells were washed once with CGXII medium without carbon source and inoculated to an initial OD600 of 1. Glucose was added as carbon and energy source to a concentration of 100 mM. Standard cultivations of C. glutamicum were performed at 30°C in a volume of 50 ml in 500 ml flasks with two baffles shaking at 120 rpm. The OD600 was measured in dilutions using a Shimadzu UV-1202 spectrophotometer (Duisburg, Germany). For cloning, E. coli DH5α was used as host and cultivated in LB medium at 37°C. When appropriate kanamycin or spectinomycin were added to concentrations of 25 μg/ml and 100 μg/ml, respectively.

Biodivers Conserv 14:2633–2652CrossRef Danielsen F, Burgess ND, Balmford A, Donald PF, Funder M, Jones JPG, Alviola P, Balete DS, Blomley T, Brashares J et al (2008)

Local participation in natural resource monitoring: a characterization of approaches. Conserv Biol 23(1):31–42PubMedCrossRef DeNeve KM, BAY 63-2521 price Heppner MJ (1997) Role play simulations: the assessment of an active learning technique and comparisons with traditional lectures. Innov High Educ 21:231–246CrossRef Evans KA, Guariguata MR (2007) A global review of participatory monitoring in tropical forest management. CIFOR, Bogor Foppes J (2008) Knowledge capitalization: agriculture and forestry development at “Kum Ban” Village cluster level in Lao PDR. Technical report, Adavosertib concentration LEAP and NAFES Fraser EDG, Dougill AJ, Mabee WE, Reed M, McAlpine P (2006) Bottom up and top down: analysis of participatory processes for sustainability indicator identification as a pathway to community empowerment and sustainable environmental management. J Environ Manag 78:114–127CrossRef Garcia CA, Lescuyer G (2008) Monitoring, indicators and community based forest management in the tropics: pretexts or red herrings? Biodivers Conserv 17(6):1303–1317CrossRef Hargitai HI (2006) Planetary maps: visualization and nomenclature.

Cartographica 41(2):150–164CrossRef Laumonier Y, Bourgeois R, Pfund J-L (2008) Accounting for the ecological dimension in participatory research and development: lessons learned from Indonesia and Madagascar. Ecol Soc 13:22 Lestrelin G, Bourgoin J, Bouahom B, Castella J-C (2011) Measuring participation: case studies on village land use planning in northern Lao PDR. Appl Geogr 31:950–958CrossRef MAF Acesulfame Potassium (2008) Ministerial

direction of the Minister of Agriculture and Forestry on “establishing agriculture and forestry technical service center” MAF, PF-02341066 price Vientiane MAF, NLMA (2009) Participatory Agriculture and Forest Land Use Planning at Village and Village Cluster Level. Report, Ministry of Agriculture and Forestry and National Land Management Authority MAF, NLMA (2010) Participatory Agriculture and Forest Land Use Planning at Village and Village Cluster Level. Report, Ministry of Agriculture and Forestry and National Land Management Authority NAFRI, NAFES, NUOL (2005) Improving livelihoods in the upland of the Lao PDR, Volume 1: Initiatives and approaches. National Agriculture and Forestry Research Institute, Vientiane NAFRI, NUOL, SNV (2007) Non-Timber Forest Products in the Lao PDR. A Manual of 100 Commercial and Traditional Products. The National Agriculture and Forestry Research Institute, Vientiane Noss AJ, Oetting I, Cuéllar RL (2005) Hunter self-monitoring by the Isoseño-Guaraní in the Bolivian Chaco.