Smac mimetics can provoke lytic cell death that is neither apoptotic nor necroptotic

Mark A. Miles1 · Sarah Caruso1 · Amy A. Baxter1 · Ivan K. H. Poon1 · Christine J. Hawkins1

Abstract
Smac mimetics, or IAP antagonists, are a class of drugs currently being evaluated as anti-cancer therapeutics. These agents antagonize IAP proteins, including cIAP1/2 and XIAP, to induce cell death via apoptotic or, upon caspase-8 deficiency, necroptotic cell death pathways. Many cancer cells are unresponsive to Smac mimetic treatment as a single agent but can be sensitized to killing in the presence of the cytokine TNFα, provided either exogenously or via autocrine production. We found that high concentrations of a subset of Smac mimetics could provoke death in cells that did not produce TNFα, despite sensitization at lower concentrations by TNFα. The ability of these drugs to kill did not correlate with valency. These cells remained responsive to the lethal effects of Smac mimetics at high concentrations despite genetic or pharmacological impairments in apoptotic, necroptotic, pyroptotic, autophagic and ferroptotic cell death pathways. Analysis of dying cells revealed necrotic morphology, which was accompanied by the release of lactate dehydrogenase and cell membrane rupture without prior phosphatidylserine exposure implying cell lysis, which occurred over a several hours. Our study reveals that cells incapable of autocrine TNFα production are sensitive to some Smac mimetic compounds when used at high concen- trations, and this exposure elicits a lytic cell death phenotype that occurs via a mechanism not requiring apoptotic caspases or necroptotic effectors RIPK3 or MLKL. These data reveal the possibility that non-canonical cell death pathways can be triggered by these drugs when applied at high concentrations.

Keywords Smac mimetic · IAP antagonist · Apoptosis · Necroptosis · Cell death

 

Introduction

Inhibitor of apoptosis (IAP) proteins are a class of pro-sur- vival proteins that regulate cell survival and proliferation. Many cancer types over-express various IAPs and this may confer resistance to apoptotic stimuli to render some cancers unresponsive to conventional therapies such as chemother- apy [1–3]. For instance, enhanced expression of X-linked IAP (XIAP), cellular IAP 1 and 2 (cIAP1/2), and (to a lesser extent) survivin and NAIP, were observed in patient-derived glioblastoma cells that were resistant to chemotherapies [4].
Antagonizing the function of IAPs has therefore been an attractive target as a novel anti-cancer therapy, particularly for treating chemoresistant cancers. IAPs counteract pro- death signaling and share structural similarities in that they contain at least one Baculoviral IAP repeat (BIR) domain. XIAP contains three BIR domains, two of which interact with the IAP-binding motifs (IBM) of caspases-3, -7 or -9 to suppress their pro-apoptotic activities [5]. At the intra- cellular region of the TNF receptor 1 (TNFR1), RIPK1 is polyubiquitinated by cIAP1/2, which function as E3 ubiq- uitin ligases, to activate NF-κB-mediated pathways upon TNFα signaling and indirectly suppresses caspase-8 activ-

Electronic supplementary material The online version of this article (https://doi.org/10.1007/s10495-020-01610-8) contains supplementary material, which is available to authorized users.
ity, resulting in cell proliferation and migration [6]. Smac mimetics, also known as “IAP antagonists”, were developed to mimic the N-terminal portion of the cellular Smac/Dia- blo protein to enable binding to the BIR domains of these

*
[email protected]
and other IAPs [7, 8]. This can result in the relief of XIAP- mediated caspase inhibition and/or the auto-ubiquitination

1 Department of Biochemistry and Genetics, La Trobe Institute for Molecular Science, La Trobe University, Bundoora, VIC 3086, Australia
and degradation of cIAP1/2 [9]. Loss of cIAP1/2 leads to the de-ubiquitination of RIPK1 and its participation in the
Vol.:(0123456789)
◂Fig. 1 Various cell types respond to single agent treatment with BV6 or SM164 while LCL161 and Birinapant only impact a subset of these cell types. a–d Specified cell lines were incubated for 24 h with increasing concentration of various Smac mimetics in the pres- ence or absence of 1 ng/ml TNFα (or 10 pg/ml for LN18 cells), or left untreated. Cell viability was measured using the MTT reagent. Published peak plasma concentrations (Cmax) in humans are also indi- cated. e Cell death was measured following 24 h exposure to specified Smac mimetics by staining for annexinV-FITC and propidium iodide (PI) and analysed by flow cytometry (n = 3, ± SEM) (Color figure online)
“ripoptosome” complex, thereby activating caspase-8 and propagating extrinsic apoptotic cell death, or in conditions of caspase-8 deficiency, the formation of the “necrosome” [10–12]. Within the necrosome, interactions between the RHIM domains of RIPK1 and RIPK3 promote the phospho- rylation and activation of RIPK3 as well as the pseudokinase MLKL, leading to caspase-independent necroptotic death characterized by MLKL oligomeric pores on the plasma membrane [13].
Smac mimetics vary in their specificity towards XIAP and cIAP1/2 based on their affinity for BIR2 and/or 3 domains [14]. Their potency can also reflect their valency properties. AT406/Debio1143, GDC0152 and LCL161 are monovalent as they interact at one site of an IAP protein, whereas biva- lent compounds like Birinapant, BV6 and SM164 target two such sites [15–18]. BV6, GDC0152, LCL161 and SM164 bind to cIAP1 and XIAP with similar affinities whereas Biri- napant and AT406 bind to cIAP1 50- or 13-fold more tightly than to XIAP, respectively [18–23]. These compounds may also bind to other IAPs, such as ML-IAP/Livin, NAIP and survivin, but the affinities of most of the drugs to these other family members have not been reported. In addition to stimulating direct tumor cell death, Smac mimetics can stimulate anti-tumor immunity due to the ability of these drugs to activate immunogenic pathways such as secretion of inflammatory cytokines from myeloid cells [24–29]. This pro-inflammatory tendency of Smac mimetics, like LCL161, can provoke the dose-limiting toxicity of cytokine release syndrome, which can be triggered by autocrine TNFα pro- duction in patients given excessive doses [16, 30, 31]. Early phase clinical trials of Smac mimetics such as AT406, Biri- napant and LCL161 have determined tolerable doses but have yet to produce overwhelming success as monothera- pies, however a subset of patients have responded to Smac mimetics plus chemotherapy [30, 32–34]. Therefore, the efficacy of Smac mimetics probably hinges on the ability of these agents to sensitize tumor cells to other death promoting stimuli, as has been reported in vitro [35–38].
Our previous studies evaluating the in vitro effect of Smac mimetics revealed varied responses to treatment as a single agent in different cell lines. Some cell types like osteosar- coma required the addition of TNFα for Smac mimetics

to exert their killing effect [39, 40], although some Smac mimetics were more effective than others. On the other hand, LN18 or MEF cells were responsive to high concentrations of LCL161 but not AT406 [41]. Cells that were reported to respond to Smac mimetic killing at low micromolar or even nanomolar range were shown to produce autocrine TNFα via non-canonical NF-κB pathways [22, 42–44]. Our observa- tion that GDC0152 could impair the clonogenicity of TK6 lymphoid cells at low micromolar concentrations that did not require exogenous or autocrine production of TNFα [45], led us to speculate whether cell type and/or drug concentration influenced the activation of conventional or alternative cell death pathways upon Smac mimetic exposure.
This study therefore investigated the mechanism of Smac mimetic killing as sole agents in different cell types to ascertain how Smac mimetics could provoke cell death in the presence or absence of TNFα. Using four different cell types, we found that only some Smac mimetics were effec- tive at killing as sole agents, and only when applied at high concentrations. Co-treatment with TNFα sensitized all cell types, but cell death upon exposure to high concentrations of Smac mimetic without exogenous TNFα occurred via a non-apoptotic, non-necroptotic lytic mechanism that was not dependent on autocrine TNFα production.
Results

Some Smac mimetics kill cells at high micromolar concentrations

A panel of Smac mimetics were tested in various cell types to investigate their capacity to kill as sole agents. LN18 glio- blastoma, HT29 colorectal adenocarcinoma, U937 promono- cytic and murine embryonic fibroblast (MEF) cells were not sensitive to low micromolar concentrations of Smac mimet- ics, although a subset of Smac mimetics were toxic to some but not all cell lines at higher concentrations (Fig. 1a–d). The highest dose of 100 µM BV6 or SM164 impaired viability of all the cell lines tested whereas all cells survived incubation with 100 µM AT406 and GDC0152 (Fig. 1a–d). Birinapant killed only U937 cells, whereas 100 µM of LCL161 killed LN18 and HT29 but not U937 or MEF cells. Co-treatment with TNFα with as little as 1 µM of all the Smac mimetics reduced the viability of all cell lines, although the toxicity of these combinations varied between cells and drugs.
To confirm that the reduction in cell viability we observed by measuring the absorbance of reduced MTT indeed reflected cell death, rather than being a result of diminished cellular proliferative or metabolic capacity, treated cells were stained with annexin-V-FITC and propidium iodide (PI) to detect exposure of phosphatidylserine (apoptosis marker) or membrane permeabilization, respectively (Fig. 1e). A large
proportion of cells positive for both annexin-V-FITC and PI were observed upon 100 µM exposure to BV6, LCL161 or SM164 compared to untreated cells for all cell types, although 100 µM LCL161 did not kill U937 or MEF cells to the same extent. AT406 failed to stimulate cell death, while approximately 20–40% of HT29 or U937 cells died following exposure to 30 µM of BV6.
The above results indicate that BV6, LCL161 and SM164 can kill multiple cell types, independent of the addition of exogenous TNFα, however a moderate micromolar con- centration (30–100 µM) was required to achieve this. This concentration is greater than fivefold higher than pub- lished peak plasma concentrations (Cmax) of these drugs in humans [16, 20, 31, 46]. Although these levels are beyond what may be achieved physiologically there are studies that have evaluated in vitro cellular responses to similarly high concentrations of these drugs [47–53], some even using up to 500 µM [50–52]. We therefore wanted to elucidate the modes of cell death that could be achieved at these high doses given that other researchers have also analyzed the effect of Smac mimetic exposure at these concentrations. Of the Smac mimetics that displayed killing capacity as a sole agent amongst the cell lines tested, only LCL161 has progressed to clinical trials. LCL161 was thereby selected for further characterization of Smac mimetic-induced killing as a sole agent.

Death induced by high concentrations of Smac mimetics is neither apoptotic nor necroptotic

Smac mimetics can induce two main forms of cell death: apoptosis and/or necroptosis, which can emanate from TNFα-ligation of TNFR1. We wanted to explore whether Smac mimetic-induced cell death (at high concentrations) in the absence of TNFα also activated these cell death path- ways. DEVDase activity, reflecting executioner caspase activity, increased in LN18 and (to a lesser extent) HT29 cells after 24 h exposure to 100 µM LCL161 while high activity could be detected earlier in U937 cells (Fig. 2a). Co-treatment with 10 µM LCL161 (a tenfold lower dose) and TNFα enhanced DEVDase activity rapidly in LN18 cells, whereas caspase activity was similar in U937 cells upon both treatment conditions. Pre-treatment with the pan caspase inhibitor Q-VD-OPh (QVD) abolished DEVDase activity (Fig. 2a). Although caspase activity was no longer detected, HT29 and U937 cells displayed phosphatidylserine binding and/or membrane permeabilization upon LCL161/
TNFα co-treatment in the presence of QVD (Fig. 2b), con- sistent with previous characterizations of these cell types being susceptible to caspase-independent necroptotic death [54]. This stimulus, however, failed to kill LN18 cells, prob- ably because these cells lack RIPK3 expression (Fig. 2c), which has been published to dictate cell sensitivity to

necroptotic stimuli [55]. Despite QVD blocking LCL161/
TNFα-induced death in LN18 cells, 100 µM LCL161 pro- voked death in the presence or absence of QVD. HT29 cells, which express RIPK3, were also sensitive to 100 µM LCL161 in the presence of QVD. Interestingly, caspase inhi- bition protected U937 cells from 100 µM LCL161-induced death. LCL161/TNFα/QVD promoted the phosphorylation of MLKL (most likely by activated RIPK3) in HT29 and U937 cells but this was not detected in any cell type follow- ing exposure to 100 µM LCL161, even in the presence of QVD (Fig. 2d). These data imply that exposure to LCL161 without TNFα could induce a caspase-independent form of cell death in LN18 and HT29 cells, which is not associated with MLKL phosphorylation.
We decided to remove key effectors of apoptotic and necroptotic cell death pathways to elucidate the requirement of these proteins for Smac mimetic-induced death at high concentrations. CRISPR/Cas9 was used to generate LN18 (Fig. 3a), HT29 (Fig. 3b) or U937 (Fig. 3c) cell line deriva- tives lacking expression of apoptotic executioner caspases-3 and -7 (C3/7 DKO) or necroptotic effectors RIPK3 (if endog- enously expressed) or MLKL. Death induced by LCL161/
TNFα co-treatment was blocked in all cell types lacking executioner caspases indicating this stimulus provoked caspase-dependent apoptosis. LCL161/TNFα co-treatment in the presence of QVD failed to kill HT29 or U937 cells deficient in either RIPK3 or MLKL indicating this stimulus provoked RIPK3-/MLKL- dependent necroptosis in these cell types. LCL161 was able to kill LN18 and HT29 cells, QVD-pretreated or not, regardless of executioner caspase, RIPK3 or MLKL expression. The death induced by 100 µM LCL161 was eliminated in U937 cells lacking executioner caspases or pretreated with QVD.
These experiments were repeated in parental cells using chemical inhibitors of RIPK1 (necrostatin-1; Nec-1), RIPK3 (GSK’872) or MLKL (necrosulfonamide; NSA) (Fig. 3d). Necroptotic death stimulated by LCL161/TNFα and QVD pretreatment was blocked by Nec-1, GSK’872 or NSA in HT29 and U937 cells. LCL161 killed HT29 or LN18 cells to a similar extent regardless of RIPK1, RIPK3 or MLKL inhi- bition, mirroring the responses of the knockout cell lines. Only U937 cells showed a significant reduction in cell death triggered by LCL161/TNFα when RIPK1 was inhibited with Nec-1. The data thus far indicate that LN18 and HT29 cells responded similarly to 100 µM LCL161 exposure (by undergoing non-apoptotic, non-necroptotic death) whereas the small proportion of U937 cells that were responsive to this stimulus appeared to die by apoptosis, as it was block- able by QVD or the removal of executioner caspases. To test whether the response in U937 cells observed upon LCL161 exposure was similar or different to other Smac mimetic compounds, we pretreated these cells with caspase, RIPK1, RIPK3 or MLKL inhibitors then treated with BV6 and

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
Fig. 2 LCL161-mediated killing is not caspase-dependent in LN18 or HT29 cells. Cells were treated for 8 or 24 h with 100 μM LCL161 alone, or 10 μM LCL161 plus 10 ng/ml TNFα (or 10 pg/ml for LN18 cells), after pretreatment or not with 10 μM Q-VD-OPh (QVD). a DEVDase activity was measured using the Caspase-3/7-Glo reagent or b cell death detected by annexinV-FITC and PI staining (n = 3,

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

± SEM). c Immunoblotting was conducted on untreated lysates to determine basal expression of RIPK3, RIPK1, MLKL, caspase-8 and GAPDH, or d phosphorylated and total MLKL levels in cells treated as per panels A&B. Asterix (*) indicates lysate from HT29 cells treated with 10 μM LCL161, 1 ng/ml TNFα plus 10 μM QVD for 24 h as a positive control (Color figure online)
◂Fig. 3 Genetic removal or pharmacological inhibition of RIPK3 or MLKL does not impact LCL161 killing in LN18 or HT29 cells. CRISPR/Cas9-generated MLKL, RIPK3 or CASP 3/7 (C3/7 DKO) knockout or Cas9 control a LN18, b HT29 or c U937 lines were treated for 24 h with 100 µM LCL161 alone, or 10 µM LCL161 plus TNFα, after pretreatment or not with 10 µM QVD. Cell death was measured by annexin-V-V450 and PI staining. Immunoblot- ting was used to determine expression levels of indicated proteins. d Cell death was also determined in parental cells pretreated for 1 h with either 10 µM necrostatin (Nec-1) or GSK’872, or 1 µM necro- sulfonamide (NSA), in combination or not with 10 µM QVD prior to the addition of LCL161 alone or with TNFα. Two-way ANOVA with Tukey post-tests were used to estimate the probability that ran- dom chance accounted for the differences observed in sensitivity between control cells and knockout/inhibitor-treated lines (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns p > 0.05; n = 3, ± SEM) (Color figure online)

SM164 (Supplementary Fig. 1), which also caused single agent death at higher concentrations. Unlike LCL161, death induced by high micromolar exposure to BV6 or SM164 was unaffected by QVD. Neither Nec-1, GSK’872 nor NSA altered sensitivity to those Smac mimetics. Treating cells with TNFα and 10 µM BV6 or SM164 induced death that could be blocked by Nec-1, GSK’872 or NSA in the pres- ence of QVD. This demonstrates alternative responses to different Smac mimetics in U937 cells, but also that expo- sure to high amounts of some Smac mimetics can provoke apoptotic- or necroptotic-independent death in this cell line.
To address the involvement of caspase-8, the initiator caspase that interacts (indirectly) with RIPK1 and deter- mines apoptotic or necroptotic cell fate upon TNFα and Smac mimetic treatment [56], we generated LN18 lines [57] stably expressing FLAG-tagged versions of the Spi2 protein CrmA, which is an efficient inhibitor of caspases-8 and -1 [58], or MBP as a control (Fig. 4a). LCL161 plus TNFα induced DEVDase activity and impaired cell viabil- ity in MBP expressing cells whereas the CrmA clones did not exhibit DEVDase activity and remained viable (Fig. 4b, c), implying these cells did not undergo caspase-8-mediated activation of executioner caspases. Expression of CrmA did not alter the lethality of 100 µM LCL161 indicating neither caspase-8 nor caspase-1 was required for death. Gasdermin D (GSDMD) is a pore-forming protein that is cleaved fol- lowing the activation of caspase-1 and the inflammasome to execute pyroptotic cell death [59]. We failed to detect cleav- age of GSDMD in LCL161-treated cells (Fig. 4d) ruling out caspase-1 mediated cleavage of GSDMD as the underlying the mechanism of cell death in this context.

LN18 and HT29 cells do not autocrine produce TNFα

Certain cell types are sensitive to Smac mimetic killing by stimulating autocrine TNFα production [43]. To test whether the lethality of Smac mimetic treatment we observed was a result of autocrine TNFα production, a TNFα neutralizing

antibody was added to the culture media prior to treating the cells with LCL161 or GDC0152, to block the activ- ity of any secreted TNFα. SKOV3 is a cell type with the capacity to secrete TNFα upon Smac mimetic treatment [60]. Both 100 µM LCL161 and 10 µM LCL161 plus TNFα induced caspase activity and death in SKOV3 cells in a caspase-3/7-dependent manner that could be blocked by QVD (Supplementary Fig. 2). Neutralization of TNFα pro- tected SKOV3 cells from death induced by 30 or 100 µM GDC0152 or 30 µM LCL161 (Fig. 5a), implying these agents stimulated autocrine TNFα secretion and subsequent activation of apoptotic signaling in this cell type. In contrast, both LN18 and HT29 cells maintained equivalent sensitivity to LCL161 and (to a lesser extent) GDC0152 in the presence or absence of the TNFα neutralizing antibody. These data, coupled with the ability of exogenous TNFα to cooperate with Smac mimetics to kill LN18 and HT29 cells, suggested these Smac mimetics did not induce autocrine production of TNFα in these cell lines.
We next monitored cIAP1/2 levels to confirm the on- target biochemical effects in drug-treated cells given that TNFα, either derived exogenously or via autocrine synthe- sis, was not required for Smac mimetics to kill at 100 µM. cIAP1 and 2, as well as XIAP and survivin were expressed in LN18, HT29 and U937 cells, while ML-IAP expression was detected only in U937 cells. We failed to detect NAIP expression in any of these cell types (Fig. 5b). Concentra- tions of Smac mimetics required to promote cIAP1/2 deg- radation were as low as 1 µM (Fig. 5c). Thus, even though degradation of cIAP1/2 was evident at these lower con- centrations, cell death could not be achieved unless about 30–100 times more of the drugs were used, or unless exog- enous TNFα was provided.

Inhibitors of autophagy or ROS do not affect Smac mimetic‑induced death provoked at high concentrations

The data presented above suggested that exposure to Smac mimetics in the absence of TNFα could provoke a mode of cell death that was neither apoptotic nor necroptotic. We assessed whether this stimulus could therefore activate other forms of cell death. Various Smac mimetics have been reported to regulate autophagy signaling [61–65]. We looked at LC3B-II abundance to explore this as this protein is recruited to autophagosomal membranes during autophagy [66]. High amounts of LCL161 alone or in com- bination with TNFα increased LC3B-II levels in LN18 and HT29 cells (Fig. 6a), suggesting enhanced autophagosome synthesis or reduced autophagosome recycling, and thus the possibility of autophagy activation. Interestingly, LC3B-II levels were also elevated in 100 µM LCL161- or LCL161/
TNFα-treated U937 cells but this was most pronounced in

Fig. 4 Over expression of CrmA does not affect sensitivity to ▸ LCL161 as a sole agent. LN18 cells were transfected with plasmids encoding FLAG tagged MBP or CrmA. a Expression of FLAG constructs in two independent clones was determined by immunob- lot. Stable lines were treated with 100 µM LCL161 alone, or 10 µM LCL161 plus 10 pg/ml TNFα then b cell viability assessed by CellTi- tre-Glo after 48 h or c DEVDase activity after 8 h. Two-way ANOVA with Bonferroni post-tests were used to estimate the probability that random chance accounted for the differences observed in sensitivity between MBP and CrmA stable lines (****p < 0.0001; ns p > 0.05;
n = 3, ± SEM). d Lysates from cells treated with 100 µM LCL161 for 8 or 24 h, or not, were assessed for GSDMD cleavage (left blot). Untreated HT29 lysate was incubated with 385 nM recombinant cas- pase-1 at 37 °C for 30 min before SDS-PAGE and immunoblotting to detect GSDMD (right blot) (Color figure online)
the presence of QVD. Treatment of cells with bafilomycin A1, an autophagy inhibitor that disrupts autophagic flux and autophagosome-lysosome fusion [67], using concen- trations that were minimally toxic to untreated cells, did not alter sensitivity to 100 µM LCL161 (Fig. 6b). These data suggest that LCL161 can upregulate LC3B-II levels (prob- ably increasing autophagic flux), but this does not reflect autophagy-mediated death.
Smac mimetics have also been reported to impact redox regulation in cells, often as a consequence of necroptotic signaling or mitochondrial damage [68–72]. We therefore treated cells with reactive oxygen species (ROS) inhibitors to address whether a build-up of lipid or oxidative ROS contributed to Smac mimetic-induced death. Erastin inhib- its cystine uptake to deprive the cell of the antioxidant glu- tathione thereby raising the lipid ROS content within cells, and is a known inducer of ferroptosis, a recently described form of iron-dependent non-apoptotic death [73]. Erastin impaired cell viability in LN18 (Fig. 7a) or HT29 (Fig. 7b) cells, which could be rescued by the ferroptosis inhibitor and lipid peroxidase scavenger ferrostatin-1 (Fer-1) [74], or the antioxidant N-acetylcysteine (NAC), which is a glutathione precursor [75]. Interestingly, neither Fer-1 nor NAC signifi- cantly altered the response to erastin in U937 cells (Fig. 7c). These inhibitors were unable to impact the lethality of BV6, LCL161 or SM164 (at 30 or 100 µM), or LCL161/TNFα co-treatment on cell viability in any of the cell lines tested. This emphasizes a protective role that Fer-1 and NAC play in scavenging lipid ROS upon erastin exposure (at least in LN18 and HT29 cells) but reveals that these inhibitors do not affect death induced by high concentrations of Smac mimetics.
necrotic features as highlighted by the majority of treated

High concentrations of Smac mimetics induces cell lysis

Although the death we observed following incubation with Smac mimetics as sole agents did not involve the activity of key apoptotic or necroptotic effectors, cells displayed
cells staining double positive for annexin-V and PI in our initial flow cytometry experiments (Fig. 2b). Time course analyses were conducted in LN18 (Fig. 8a), HT29 (Fig. 8b) or U937 (Fig. 8c) cells to determine the kinetics of mem- brane permeabilization and phosphatidylserine exposure fol- lowing LCL161 or LCL161/TNFα combination treatment.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
Fig. 5 Smac mimetic treatment does not induce autocrine TNFα production in LN18 or HT29 cells. a SKOV3, LN18 or HT29 cells were incubated with LCL161 or GDC0152 for 24 h in the presence or absence of 10 ng/ml TNFα antagonistic antibody. ATP levels reflecting cell viability were measured with the CellTiter-Glo reagent. Two-way ANOVA with Bonferroni post-tests were used to estimate the probability that random chance accounted for the differences observed in sensitivity in the presence of TNFα neutralization or not

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

(**p < 0.01; ***p < 0.001; ns p > 0.05; n = 3, ± SEM). b Basal expres- sion levels of various IAPs were determined by immunoblot. D2247 cell lysate [94] was included as a positive control for NAIP expres- sion. c LN18 cells were treated with 1, 10 or 100 µM Smac mimetic (LCL161, BV6, SM164 or GDC0152) or 10 µM LCL161 plus 10 pg/
ml TNFα, or left untreated for 30 min, then lysed and subjected to immunoblotting to determine cIAP1/2 and GAPDH expression (§ indicates non-specific band) (Color figure online)
LCL161/TNFα co-treatment led to the externalization of phosphatidylserine prior to the disruption of the plasma membrane in all cell types, representative of apoptotic death. HT29 and U937 cells treated with LCL161/TNFα in the presence of QVD had their membranes permeabilized at the same time as annexin-V staining of phosphatidylser- ines implying necroptotic (necrotic) death. The kinetics of LN18 and HT29 cells, in which 100 µM LCL161 induced cell death that was neither apoptotic nor necroptotic resem- bled necroptotic death: simultaneous plasma membrane disruption and access of annexin-V to phosphatidylserine.

Time lapse microscopy revealed membrane lysis occurred in LN18 cells treated after 10 h exposure to LCL161 (Fig. 8d). Membrane changes and PI uptake occurred simultaneously. Interestingly, the morphology at earlier time points revealed some evidence of vacuolation within the cytoplasm prior to cell detachment although this was not extensive throughout the cell and, based on our observations, underrepresented the number of cells that stained positive for annexin-V or PI (Fig. 8e). Rounded cells displayed a bubbled surface prior to a conventional necrotic morphology that was illustrated by a highly granular appearance. We also measured the amount

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig. 6 LC3B-II levels are enhanced in LCL161 treated cells. a Cells were treated for 8 or 24 h with 100 µM LCL161 alone, or 10 µM LCL161 plus 1 ng/ml TNFα (or 10 pg/ml for LN18 cells), after pre- treatment or not with 10 µM QVD. Lysates were subjected to immu- noblotting using an antibody that can detect LC3B-II or GAPDH. b LN18 or HT29 cells were pretreated for 1 h with indicated amounts of bafilomycin A1, then 100 µM LCL161 was added to the media. Cell viability was determined by measuring ATP levels via CellTiter- Glo after 48 h. Two-way ANOVA with Bonferroni post-tests were used to estimate the probability that random chance accounted for the differences observed in sensitivity between treated or untreated cells (***p < 0.001; ****p < 0.0001; n = 3, ± SEM) (Color figure online)

of LDH released into the culture media as an indicator of cell lysis (Fig. 8f). There was enhanced LDH activity present in the media as early as 6 or 12 h of exposure to 100 µM LCL161. LCL161/TNFα co-treatment resulted in LDH

release, but only after 24 h, correlating with the onset of secondary necrosis.
Discussion

Some Smac mimetics are currently being evaluated for can- cer treatment, as inhibiting the function of pro-survival IAPs may induce tumor cell death or at least sensitize chemo- resistant tumors to death promoting stimuli. We set out to define the differential responses of some cell types to various Smac mimetics to assist in the interpretation of studies test- ing these and newer compounds in the future.
LN18 or HT29 cells exposed to 100 µM of LCL161 died via a mechanism that did not require caspases (specifically caspases-1, -3, -7 or -8), RIPK1, RIPK3 or MLKL. These cell death pathway components, however, were essential for apoptotic or necroptotic death induced by lower concentra- tions of LCL161 in the presence of TNFα. High concentra- tions of LCL161 depleted levels of intracellular ATP (as measured by the CellTiter-Glo assay) and the resultant cell death was associated with LDH release and necrotic mor- phology, but did not result from autocrine TNFα production. We therefore propose that exposure to relatively high Smac mimetic concentrations can induce cell lysis that is not dic- tated by classical apoptotic or necroptotic pathways, at least in some cell types. This mode of cell death may account for the cytotoxicity described in other studies that have used similar, if not higher, concentrations of Smac mimetic com- pounds [47–53], possibly even confounding the interpreta- tion of some results. Curiously, U937 cells responded to high amounts of LCL161 in a way that appeared to reflect apoptosis: removal of caspase activity protected cells. It is interesting to note that QVD protected U937 cells under this condition, but caspase inhibition in the presence of TNFα enabled switching of extrinsic apoptotic signaling to necrop- totic signaling. This suggests that LCL161 may have relieved XIAP-mediated inhibition of caspases without stimulating ripoptosome formation following cIAP1/2 degradation. Thus, the addition of TNFα influenced how U937 cells responded to LCL161, although BV6 and SM164 too pro- voked non-apoptotic, non-necroptotic death of these cells.
It is possible that the heterogeneity observed in the sen- sitivity of different cell types to various Smac mimetics reflected the differential affinities for IAP proteins or their valency. Bivalent Smac mimetics like Birinapant, BV6 and SM164 possess two interacting moieties meaning one drug molecule can target two BIR domains within the one IAP protein, thereby enhancing their in vitro cytotoxicity when compared to monovalent compounds [9]. Indeed, the biva- lent compounds used in this study killed cells as sole agents, albeit at high concentrations. The exception to this was Biri- napant, which could kill U937 cells but not the other cell

Fig. 7 Ferrostatin-1 or N-acetylcysteine do not alter sensitivity ▸ to death provoked by Smac mimetics. a LN18, b HT29 or c U937 cells were pretreated or not with 10 µM ferrostatin-1 (Fer-1) or
1 mM N-acetylcysteine (NAC) for 1 h then incubated for 48 h with either erastin, BV6, LCL161, SM164 or 10 µM LCL161 plus 1 ng/
ml TNFα (or 10 pg/ml for LN18 cells). Cell viability was determined by measuring ATP levels via CellTiter-Glo. Two-way ANOVA with Tukey post-tests were used to estimate the probability that random chance accounted for the differences observed in sensitivity between inhibitor or DMSO treated cells (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns p > 0.05; n = 3, ± SEM) (Color figure online)
lines tested as a sole agent. This highlights the differential responses in different cell types, as U937 but not HT29 (or LN18) cells partially activated RIPK1-dependent apoptotic death upon LCL161/TNFα co-treatment even though both cell lines activated RIPK1-dependent necroptotic death in the presence of QVD. Furthermore, all cell types were sen- sitive (although to varying extents) to LCL161, which is a monovalent Smac mimetic. GDC0152 is another monovalent compound with similar affinities for XIAP and cIAP1 as LCL161 [20, 22] but cells were not responsive to GDC0152 as a sole agent, even at concentrations that enabled LCL161 lethality. GDC1052 can also bind to the BIR domain of ML- IAP with similar affinities as XIAP and cIAP1, and promote its degradation [20, 49]. Very little is known about the abil- ity of Smac mimetics to target IAPs other than XIAP or cIAP1/2 so it is possible that differences in chemical struc- ture may enable independent interactions with other IAPs for some compounds. It is unlikely though that targeting extra IAPs, like ML-IAP, to provide “enhanced” pro-sur- vival relief reflects the inability of GDC0152 to promote cell death as a sole agent, given that GDC0152 and LCL161 cooperated similarly with TNFα to kill LN18 and HT29 cells but varied dramatically in their propensity to kill these cells as sole agents. ML-IAP and NAIP were not expressed in LN18 or HT29 cells thus are unlikely to be involved in LCL161 lethality. Survivin was expressed in all lines but its affinity for Smac (and mimetic compounds) is low compared to other IAPs [72, 76, 77]. Survivin is also a unique IAP as it lacks a RING domain implying that targeting by high concentrations of Smac mimetics is unlikely to result in its degradation as has been reported previously [51, 72, 78]. We therefore speculate that the lytic mechanism involves Smac mimetic-targeting of an as-yet unidentified protein other than cIAP1, cIAP2, XIAP, ML-IAP, NAIP or survivin.
Cell death was impaired neither by inhibiting autophagic flux (with bafilomycin A1) nor ROS (with Fer-1 or NAC). LC3B-II was upregulated following treatments that caused caspase-/RIPK3-/MLKL-independent cell death. This con- trasts with a previous report describing MLKL-depend- ent upregulation of LC3B-II following Smac mimetic- induced necroptosis [79], as MLKL removal did not impact LCL161-induced death at high concentrations but

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

still enhanced LC3B-II levels. Rather, our data imply that this treatment results in “autophagy-associated” cell death [80] as an increase in autophagic flux did not modulate

 

◂Fig. 8 High micromolar LCL161 induces cell lysis in LN18 and HT29 cells. a LN18, b HT29 or c U937 cells were incubated with 100 µM LCL161 alone, or 10 µM LCL161 plus 1 ng/ml TNFα (or 10 pg/ml for LN18 cells), after pretreatment or not with 10 µM QVD for designated periods of time. Cells were stained with annexin-V- FITC or PI to identify dead and dying cells (n = 3, ± SEM). d Rep- resentative time-lapse DIC microscopy images of LN18 cells stained with PI (red) following 10 h exposure to 100 µM LCL161. Images shown were captured in 10 min intervals and are representative of two independent repeats. Top panel = differential interference con- trast (DIC); middle panel = PI; bottom panel = merged. e Representa- tive images from treated LN18 cells are shown to depict changes in morphology over time. Arrows indicate regions of cytoplasmic vacu- olation. f Membrane lysis in LN18 or HT29 cells was measured by quantitating the release of LDH into the culture media following incubation with no drug, 100 µM LCL161 alone, or 10 µM LCL161 plus 1 ng/ml (HT29) or 1 pg/ml (LN18) TNFα for the indicated times, or 30 min incubation in LDH lysis buffer. Two-way ANOVA with Tukey post-tests were used to compare the amount of LDH released for LN18 or HT29 cells at each time point for each treatment relative to untreated cells (*p < 0.05; **p < 0.01; ****p < 0.0001; ns p > 0.05; n = 3, ± SEM) (Color figure online)

LCL161-induced death. Autophagy and other stresses may also regulate ferroptotic cell death [81]. A previous report showed that BV6 co-operated with erastin or RSL3 to induce ferroptosis [82]. Those authors described minor single agent killing by BV6 at 5 µM but only attributed its involvement to ferroptosis in combination with those ferroptotic inducers. NAC and other free radical scavengers could reduce ROS accumulation and the associated necroptotic cell death fol- lowing BV6/TNFα treatment, which occurred upon RIPK3 activation within the necrosome [68]. ROS production was also RIPK3-dependent in macrophages co-treated with LPS and Smac mimetic, which was blocked by NAC [83]. The removal of RIPK3 activity in our study did not suppress Smac mimetic-induced death at high doses, thus we would expect NAC to provide some protection if RIPK3-induced ROS production did occur. Our observation that higher con- centrations of BV6 and other Smac mimetics maintained killing capacity even in the presence of ROS scavengers, which impaired erastin-induced death, indicates that ROS production was probably not a factor in the death pro- voked by these treatments. These results bear similarities to a recent report evaluating the in vitro anti-cancer potency of a novel XIAP antagonist in which zVAD-(OMe)-fmk, Nec-1 or Fer-1 could not block cell death [84], although those researchers did detect ROS accumulation following mitochondrial damage.
Our study demonstrates that low micromolar concentra- tions of drug are enough to activate classical apoptotic or necroptotic cell death pathways in the presence of TNFα (in responsive cells) but higher amounts in the absence of TNFα induce cell lysis. Cleavage of gasdermins, such as GSDMD, can provoke lytic death resulting in pyroptosis and GSDMD cleavage can be catalyzed by serine proteases

as well as caspases [59, 85]. QVD potently inhibits most caspases, even caspase-1 [86, 87], which is activated by the inflammasome and promotes pyroptotic death [88]. Additionally, CrmA possesses dual inhibitory specific- ity for both caspase-1 and -8 [57]. We therefore suspect that any active caspase-1 would be efficiently inhibited by QVD or CrmA, so their inability to protect cells from death triggered by high levels of LCL161 coupled with the absence of GSDMD cleavage implies that the inflamma- some is not activated and caspase-1 mediated pyroptotic death is unlikely to be the mechanism by which these drugs provoke cell lysis. It is possible for other gasdermins to be activated by proteases other than caspases [85], although to date no link has been published between Smac mimetics and caspase-independent activation of gasdermins, there- fore it is unclear if these pore-forming proteins play a role in the non-apoptotic/-necroptotic death we describe.
It is tempting to interpret our observations as an “off- target” effect of excessive amount of drug that binds to membrane phospholipids leading to membrane rupture, particularly at high concentrations. However, the impact of high dose LCL161 on cell morphology and PI uptake occurred beyond 10 h after treatment commenced, imply- ing these drugs were stimulating biochemical pathways that led to lysis rather than directly permeabilizing mem- branes. The kinetics of this form of cell death differ from those involving direct plasma membrane binding mole- cules, such as the binding of cationic defensins to phos- phoinositides that rapidly induce membrane lysis within minutes [89]. The necrotic morphology of dying cells was preceded by evidence of vacuolation of parts of the cyto- plasm in a minority of cells. While this bears resemblance to other modes of cell death such as paraptosis [90] the lack of extensive vacuolation suggests that this may not be a major determinant of death. We therefore suspect that the lethality provoked by relatively high concentrations of Smac mimetics reflects an “on-target” response due to some (but not all) Smac mimetic compounds inefficiently targeting one or more proteins that protect against a cur- rently uncharacterized lytic cell death pathway. If drugs are developed to specifically target these proteins with high affinity to enable activation of this lytic pathway then this may be achieved using drug concentrations that are within a physiological range. While the non-apoptotic, non-necroptotic mode of cell death seemed to manifest at concentrations that may not necessarily be achieved by all drugs, this study provides evidence that some Smac mimetic compounds can indeed activate non-canonical cell death pathways. We implore other researchers to interpret their data carefully when applying these drugs at such concentrations.
Methods

Cell lines and reagents

LN18 (purchased from ATCC), SV-40 transformed mouse embryonic fibroblasts (MEF; kindly provided by Anissa Jabbour and Paul Ekert) and HT29 (kindly provided by James Murphy) cells were cultured in Dulbecco’s modified Eagle medium with high glucose (Invitrogen; CA, USA). U937 (kindly provided by James Murphy) and SKOV3 (kindly provided by Nick Hoogenraad) cells were cultured in RPMI-1640 containing HEPES buffer (Invitrogen). All media was supplemented with 10% FBS (Scientifix Life, Cheltenham, VIC, Australia) and cells maintained at 37 °C in air supplemented with 5% CO2.
The following Smac mimetic drugs were used: AT406/
Debio1143 (Selleck Chemicals; Texas, USA), Birinapant (ApexBio; Texas, USA), BV6 (ApexBio), GDC0152 (Sell- eck), LCL161 (Selleck) and SM164 (ApexBio). Other rea- gents include human and murine TNFα (Peprotech; NJ, USA), Q-VD-OPh (R&D Systems), necrostatin-1 (Sigma- Aldrich; MO, USA), GSK’872 (Selleck), necrosulfona- mide (Selleck), erastin (Selleck), ferrostatin-1 (Selleck), N-acetylcysteine (Sigma-Aldrich) and bafilomycin A1 (Sigma-Aldrich).
The following antibodies were used: rabbit anti-phos- pho-MLKL Ser358 (Cell Signaling Technology; Danvers, MA, USA), rat anti-MLKL clone 3H1 (gift from James Murphy), rabbit anti-RIPK3 (Cell Signaling Technology), mouse anti-RIPK1 (BD Biosciences; San Jose, CA, USA), mouse anti-caspase-3 (BD Biosciences), rabbit anti-cas- pase-7 (Cell Signaling Technology), mouse anti-caspase-8 (Cell Signaling Technology), rabbit anti-GSDMD (Abcam, Cambridge, UK), rabbit anti-LC3B (Cell Signaling Tech- nology), mouse anti-TNFα (R&D Systems; Minneapolis, NM, USA), mouse anti-GAPDH (Merck Millipore; MA, USA), rabbit anti-cIAP1/2 (MLB Life Science, Japan), rabbit anti-cIAP1 (Cell Signaling Technology), rabbit anti-cIAP2 (Cell Signaling Technology), rabbit anti-XIAP (Cell Signaling Technology), rabbit anti-survivin (Cell Signaling Technology), rabbit anti-ML-IAP/Livin (Cell Signaling Technology), rabbit anti-NAIP (Abcam), mouse anti-actin (Sigma-Aldrich), donkey anti-rabbit-HRP (GE Healthcare Life Sciences; NJ, USA), goat anti-rat-HRP (GE Healthcare Life Sciences) and rabbit anti-mouse-HRP (Sigma-Aldrich).
Cell death and viability assays

Cell viability was measured using MTT or CellTiter- Glo assays. Ten thousand (LN18, HT29 or MEF) or

one-hundred thousand (U937) cells were seeded in clear 96-well plates containing drugs or media to a volume of 100 µl. After 24 h incubation, 20 µl of 5 mg/ml Thia- zolyl Blue Tetrazolium Blue (MTT; Sigma-Aldrich) was added to each well, plates incubated for 4 h at 37 °C, 5% CO2 then 100 µl of 10% acidified SDS added to each well. Plates were incubated overnight at 37 °C, 5% CO2 then absorbance detected at 570 nm. Alternatively, ATP activity in cells was measured using the CellTiter-Glo 2.0 assay kit (Promega; WI, USA). Two (LN18, HT29 or SKOV3) or ten (U937) thousand cells were seeded in white 96-well plates containing drugs or media and incubated for speci- fied time. CellTiter-Glo reagent was added to wells at a ratio of 1:3 and plates incubated for 10 min at room tem- perature before luminescence detection. Luminescence or absorbance detection was achieved using a Spectromax M5e (Molecular Devices; CA, USA).
Cell death was determined using flow cytometry. Cells were incubated with drugs or media for specified times then harvested and resuspended in binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2; pH 7.4) contain- ing 1:250 of annexin-V-FITC (Abcam), or annexin-V-V450 (BD Biosciences) for analysis in CRISPR knockout lines. Cells were incubated for 10 min at room temperature then an equal amount of binding buffer containing 2 µg/ml propidium iodide (Sigma-Aldrich) added. Flow cytomet- ric analysis was conducted using a FACS Canto II (BD Biosciences).
Generation of CRISPR knockout or stable transfectant cell lines

The pFUCas9mCherry and pFgh1tUTG plasmids (kindly provided by Hamsa Puthalakath and Marco Herold) were used to generate knockout cell lines via a CRISPR/Cas9 dox- ycycline-inducible sgRNA lentiviral vector system based on a previous method [91, 92]. The following oligonucleotide pairs were used to generate sgRNA plasmids for lentiviral transduction into constitutively expressing Cas9 cells:
MLKL exon 1: 5′TCCCCACAGGCTTTGTGGAATGAC C-3′, 5′-AAACGGTCATCCAGAAACGGTGTG-3’.
RIPK3 exon 1: 5′-TCCCATAACTTGACGCACGACATC
-3′, 5′-AAACGATGTCGTGCGTCAAGTTAT-3’.
CASP3 exon 2: 5′-TCCCGGAAGCGAATCAATGGA CTC-3′, 5′-AAACGAGTCCATTGATTCGCTTCC-3’.
CASP7 exon 2: 5′-TCCCGACCGGTCCTCGTTTGTACC
-3′, 5′-AAACGACCGGTCCTCGTTTGTACC-3’.
Stable LN18 cells were generated using the FuGENE HD transfection reagent (Roche; Basel, Switzerland) and selected in 3 µg/ml puromycin (Sigma-Aldrich). The pEF- FLAG-CrmA [93] and pEF-FLAG-MBP [91] plasmids have been described previously.
Immunoblotting

Cells were lysed using RIPA lysis buffer (150 mM sodium chloride, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0, supplemented with protease inhibitor cocktail; Sigma-Aldrich) by pipetting 50 times and rapid vortexing. The lysates were cleared by centrifuging for 15 min at 16,100×g at 4 °C. Total protein was determined using the bicinchoninic acid (BCA) method (Micro BCA Protein assay kit, Thermo Fisher Scientific; Massachusetts, USA). Fifty micrograms of lysates were loaded on Tris–gly- cine gels and the proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis then transferred onto Hybond PVDF 0.22 μm membrane (Millenium Sci- ence; Victoria, Australia). Membranes were blocked with 1% blocking reagent (Roche) in phosphate-buffered saline (PBS), and probed with primary antibodies then horseradish peroxidase (HRP)-conjugated secondary antibodies diluted in 1% blocking reagent (Roche) in PBS with 0.1% Tween-20 (Sigma-Aldrich). SuperSignal West Dura extended duration substrate (Thermo Fisher Scientific) was used for detection.

Caspase activity and LDH release assays

DEVDase activity in cells was determined using the Cas- pase-Glo 3/7 assay kit (Promega). Two (for LN18 and HT29 cells) or ten (for U937 cells) thousand cells were seeded in media alone or media containing drug into white 96-well plates and incubated for specified times. Caspase-Glo 3/7 reagent was added as 1:1 to each well and plates incubated at room temperature for 30 min prior to luminescence detection using a Spectromax M5e (Molecular Devices).
The release of lactate dehydrogenase (LDH) from per- meabilized cells was measured using the LDH Cytotoxic- ity Assay Kit II (Abcam), according to the manufacturer’s instructions. Twenty thousand cells were seeded in clear 96-well plates in media containing drug or no drug to a final volume of 100 µl. Cells were incubated for specified times then culture supernatants incubated with LDH reaction mix for 30 min. Absorbance was measured using a Spectromax M5e (Molecular Devices) at 450 nm. The percentage of LDH released was calculated as a percentage of total lysis as determined by 30 min incubation of cells with LDH cell lysis buffer.

Time‑lapse DIC Microscopy

To monitor LN18 cells by time-lapse microscopy, 2 × 104 cells were seeded into a 4 well Nunc Lab-Tek II chamber Slide (Nunc, Roskilde, Denmark) in 500 µl media and treated with 100 µM LCL161 then stained with 1 µg/ml PI. Imaging was performed from 10 h post-treatment at 10 min intervals using the Zeiss spinning disk confocal microscope

(Zeiss, Germany) with 63x/1.4 oil immersion objective. Other images were taken using a Zeiss Confocal LSM 780 microscope (Zeiss) under the same conditions. All imaging was performed at 37 °C with 5% CO2.

Statistical analysis

GraphPad Prism 8.0 was used to perform two-way ANOVA analyses with Bonferroni or Tukey post-tests (outlined in the figure legends), to assess the significance of differences in untreated/control and treated/test cells.

Acknowledgements We thank James Murphy for cell lines and the MLKL antibody, Marco Herold and Hamsa Puthalakath for reagents and assistance with CRISPR gene editing, Suresh Mathivanan for the LC3B antibody and bafilomycin A1 drug, and the LIMS Bioimaging Platform. This study was funded by a Cancer Council Victoria Post- doctoral Fellowship to M.A.M., a grant from The Kids’ Cancer Project and a Grant-in-Aid from the Cancer Council Victoria awarded to C.J.H.

Author contributions MAM and CJH devised the study and wrote the manuscript text. MAM and SC performed the experiments, AAB and IKHP assisted with planning experiments, MAM analyzed the data and prepared the figures.

Compliance with ethical standards

Conflict of interest The authors declare that they have no conflict of interest.
References

1.Augello C, Caruso L, Maggioni M, Donadon M, Montorsi M, San- tambrogio R, Torzilli G, Vaira V, Pellegrini C, Roncalli M, Coggi G, Bosari S (2009) Inhibitors of apoptosis proteins (IAPs) expres- sion and their prognostic significance in hepatocellular carcinoma. BMC Cancer 9:125. https://doi.org/10.1186/1471-2407-9-125
2.Pluta P, Jeziorski A, Cebula-Obrzut AP, Wierzbowska A, Pie- karski J, Smolewski P (2015) Expression of IAP family proteins and its clinical importance in breast cancer patients. Neoplasma 62(4):666–673. https://doi.org/10.4149/neo_2015_080
3.Tamm I, Kornblau SM, Segall H, Krajewski S, Welsh K, Kitada S, Scudiero DA, Tudor G, Qui YH, Monks A, Andreeff M, Reed JC (2000) Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias. Clin Cancer Res 6(5):1796–1803
4.Liu G, Yuan X, Zeng Z, Tunici P, Ng H, Abdulkadir IR, Lu L, Irvin D, Black KL, Yu JS (2006) Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma. Mol Cancer 5:67
5.Eckelman BP, Salvesen GS (2006) The human anti-apoptotic pro- teins cIAP1 and cIAP2 bind but do not inhibit caspases. J Biol Chem 281(6):3254–3260
6.Silke J, Vince J (2017) IAPs and cell death. Curr Top Microbiol Immunol 403:95–117. https://doi.org/10.1007/82_2016_507
7.Du C, Fang M, Li Y, Li L, Wang X (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102:33–42
8.Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ, Vaux DL (2000) Identification of
DIABLO, a mammalian protein that promotes apoptosis by bnd- ing to and antagonizing IAP proteins. Cell 102:43–53
9.Fulda S (2017) Smac mimetics to therapeutically target IAP pro- teins in cancer. Int Rev Cell Mol Biol 330:157–169. https://doi. org/10.1016/bs.ircmb.2016.09.004
10.Pasparakis M, Vandenabeele P (2015) Necroptosis and its role in inflammation. Nature 517(7534):311–320. https://doi. org/10.1038/nature14191
11.Schilling R, Geserick P, Leverkus M (2014) Characterization of the ripoptosome and its components: implications for anti-inflam- matory and cancer therapy. Methods Enzymol 545:83–102. https ://doi.org/10.1016/B978-0-12-801430-1.00004-4
12.Bertrand MJ, Milutinovic S, Dickson KM, Ho WC, Boudreault A, Durkin J, Gillard JW, Jaquith JB, Morris SJ, Barker PA (2008) cIAP1 and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIP1 ubiquitination. Mol Cell 30(6):689– 700. https://doi.org/10.1016/j.molcel.2008.05.014
13.Petrie EJ, Czabotar PE, Murphy JM (2018) The structural basis of necroptotic cell death signaling. Trends Biochem Sci 44(1):53–63. https://doi.org/10.1016/j.tibs.2018.11.002
14.Rathore R, McCallum JE, Varghese E, Florea A-M, Büsselberg D (2017) Overcoming chemotherapy drug resistance by targeting inhibitors of apoptosis proteins (IAPs). Apoptosis 22(7):898–919. https://doi.org/10.1007/s10495-017-1375-1
15.Allensworth JL, Sauer SJ, Lyerly HK, Morse MA, Devi GR (2013) Smac mimetic Birinapant induces apoptosis and enhances TRAIL potency in inflammatory breast cancer cells in an IAP-dependent and TNF-alpha-independent mechanism. Breast Cancer Res Treat 137(2):359–371. https://doi.org/10.1007/s10549-012-2352-6
16.Infante JR, Dees EC, Olszanski AJ, Dhuria SV, Sen S, Cameron S, Cohen RB (2014) Phase I dose-escalation study of LCL161, an oral inhibitor of apoptosis proteins inhibitor, in patients with advanced solid tumors. J Clin Oncol 32(28):3103–3110
17.Houghton PJ, Kang MH, Reynolds CP, Morton CL, Kolb EA, Gor- lick R, Keir ST, Carol H, Lock R, Maris JM, Billups CA, Smith MA (2011) Initial testing (Stage 1) of LCL161, a SMAC mimetic, by the pediatric preclinical testing program. Pediatr Blood Cancer 58(4):636–639. https://doi.org/10.1002/pbc.23167
18.Cai Q, Sun H, Peng Y, Lu J, Nikolovska-Coleska Z, McEachern D, Liu L, Qiu S, Yang CY, Miller R, Yi H, Zhang T, Sun D, Kang S, Guo M, Leopold L, Yang D, Wang S (2011) A potent and orally active antagonist (SM-406/AT-406) of multiple inhibitor of apoptosis proteins (IAPs) in clinical development for cancer treatment. J Med Chem 54(8):2714–2726. https://doi.org/10.1021/
jm101505d
19.Condon SM, Mitsuuchi Y, Deng Y, LaPorte MG, Rippin SR, Haimowitz T, Alexander MD, Kumar PT, Hendi MS, Lee YH, Benetatos CA, Yu G, Kapoor GS, Neiman E, Seipel ME, Burns JM, Graham MA, McKinlay MA, Li X, Wang J, Shi Y, Feltham R, Bettjeman B, Cumming MH, Vince JE, Khan N, Silke J, Day CL, Chunduru SK (2014) Birinapant, a smac-mimetic with improved tolerability for the treatment of solid tumors and hematological malignancies. J Med Chem 57(9):3666–3677
20.Flygare JA, Beresini M, Budha N, Chan H, Chan IT, Cheeti S, Cohen F, Deshayes K, Doerner K, Eckhardt SG, Elliott LO, Feng B, Franklin MC, Reisner SF, Gazzard L, Halladay J, Hymowitz SG, La H, LoRusso P, Maurer B, Murray L, Plise E, Quan C, Stephan JP, Young SG, Tom J, Tsui V, Um J, Varfolomeev E, Vucic D, Wagner AJ, Wallweber HJ, Wang L, Ware J, Wen Z, Wong H, Wong JM, Wong M, Wong S, Yu R, Zobel K, Fairbrother WJ (2012) Discovery of a potent small-molecule antagonist of inhibitor of apoptosis (IAP) proteins and clinical candidate for the treatment of cancer (GDC-0152). J Med Chem 55(9):4101–4113. https://doi.org/10.1021/jm300060k
21.Baggio C, Gambini L, Udompholkul P, Salem AF, Aronson A, Dona A, Troadec E, Pichiorri F, Pellecchia M (2018) Design

of potent pan-IAP and Lys-covalent XIAP selective inhibi- tors using a thermodynamics driven approach. J Med Chem 61(14):6350–6363.https://doi.org/10.1021/acs.jmedchem.8b008 10
22.Varfolomeev E, Blankenship JW, Wayson SM, Fedorova AV, Kayagaki N, Garg P, Zobel K, Dynek JN, Elliott LO, Wallweber HJ, Flygare JA, Fairbrother WJ, Deshayes K, Dixit VM, Vucic D (2007) IAP antagonists induce autoubiquitination of c-IAPs, NF-kappaB activation, and TNFalpha-dependent apoptosis. Cell 131(4):669–681
23.Lu J, Bai L, Sun H, Nikolovska-Coleska Z, McEachern D, Qiu S, Miller RS, Yi H, Shangary S, Sun Y, Meagher JL, Stuckey JA, Wang S (2008) SM-164: a novel, bivalent Smac mimetic that induces apoptosis and tumor regression by concurrent removal of the blockade of cIAP-1/2 and XIAP. Cancer Res 68(22):9384– 9393. https://doi.org/10.1158/0008-5472.CAN-08-2655
24.Dougan SK, Dougan M (2018) Regulation of innate and adap- tive antitumor immunity by IAP antagonists. Immunotherapy 10(9):787–796. https://doi.org/10.2217/imt-2017-0185
25.Knights AJ, Fucikova J, Pasam A, Koernig S, Cebon J (2013) Inhibitor of apoptosis protein (IAP) antagonists demonstrate divergent immunomodulatory properties in human immune sub- sets with implications for combination therapy. Cancer Immu- nol Immunother 62(2):321–335. https://doi.org/10.1007/s0026 2-012-1342-1
26.Kim DS, Dastidar H, Zhang C, Zemp FJ, Lau K, Ernst M, Rakic A, Sikdar S, Rajwani J, Naumenko V, Balce DR, Ewanchuk BW, Tailor P, Yates RM, Jenne C, Gafuik C, Mahoney DJ (2017) Smac mimetics and oncolytic viruses synergize in driving anticancer T-cell responses through complementary mechanisms. Nat Com- mun 8(1):344. https://doi.org/10.1038/s41467-017-00324-x
27.Dobson CC, Naing T, Beug ST, Faye MD, Chabot J, St-Jean M, Walker DE, LaCasse EC, Stojdl DF, Korneluk RG, Holcik M (2017) Oncolytic virus synergizes with Smac mimetic compounds to induce rhabdomyosarcoma cell death in a syngeneic murine model. Oncotarget 8(2):3495–3508. https://doi.org/10.18632/
oncotarget.13849
28.Beug ST, Pichette SJ, St-Jean M, Holbrook J, Walker DE, LaCasse EC, Korneluk RG (2018) Combination of IAP antagonists and TNF-alpha-armed oncolytic viruses induce tumor vascular shut- down and tumor regression. Mol Ther Oncolyt 10:28–39. https://
doi.org/10.1016/j.omto.2018.06.002
29.Beug ST, Beauregard CE, Healy C, Sanda T, St-Jean M, Chabot J, Walker DE, Mohan A, Earl N, Lun X, Senger DL, Robbins SM, Staeheli P, Forsyth PA, Alain T, LaCasse EC, Korneluk RG (2017) Smac mimetics synergize with immune checkpoint inhibi- tors to promote tumour immunity against glioblastoma. Nat Com- mun. https://doi.org/10.1038/ncomms14278
30.Chesi M, Mirza NN, Garbitt VM, Sharik ME, Dueck AC, Asmann YW, Akhmetzyanova I, Kosiorek HE, Calcinotto A, Riggs DL, Keane N, Ahmann GJ, Morrison KM, Fonseca R, Lacy MQ, Dingli D, Kumar SK, Ailawadhi S, Dispenzieri A, Buadi F, Gertz MA, Reeder CB, Lin Y, Chanan-Khan AA, Stewart AK, Fooks- man D, Bergsagel PL (2016) IAP antagonists induce anti-tumor immunity in multiple myeloma. Nat Med 22(12):1411–1420. https ://doi.org/10.1038/nm.4229
31.Amaravadi RK, Schilder RJ, Martin LP, Levin M, Graham MA, Weng DE, Adjei AA (2015) A phase I study of the SMAC- mimetic birinapant in adults with refractory solid tumors or lymphoma. Mol Cancer Ther 14(11):2569–2575. https://doi. org/10.1158/1535-7163.Mct-15-0475
32.DiPersio JF, Erba HP, Larson RA, Luger SM, Tallman MS, Brill JM, Vuagniaux G, Rouits E, Sorensen JM, Zanna C (2015) Oral Debio1143 (AT406), an antagonist of inhibitor of apop- tosis proteins, combined with daunorubicin and cytarabine in patients with poor-risk acute myeloid leukemia–results of a
phase I dose-escalation study. Clin Lymphoma Myeloma Leuk 15(7):443–449. https://doi.org/10.1016/j.clml.2015.02.020
33.Parton M, Bardia A, Kummel S, Estevez LG, Huang C-S, Castan JC, Borrego MR, Telli ML, Lluch A, Lopez R, Beck JT, Ismail-Khan R, Chen S-C, Hurvitz SA, Mayer IA, Atienza RS, Cameron S, Krygowski M, Kim S-B (2015) A phase II, open- label, neoadjuvant, randomized study of LCL161 with pacli- taxel in patients with triple-negative breast cancer (TNBC). J Clin Oncol 33(15_suppl):1014–1014. https://doi.org/10.1200/
jco.2015.33.15_suppl.1014
34.Noonan AM, Bunch KP, Chen JQ, Herrmann MA, Lee JM, Kohn EC, O’Sullivan CC, Jordan E, Houston N, Takebe N, Kinders RJ, Cao L, Peer CJ, Figg WD, Annunziata CM (2016) Pharmacodynamic markers and clinical results from the phase 2 study of the SMAC mimetic birinapant in women with relapsed platinum-resistant or -refractory epithelial ovarian cancer. Can- cer 122(4):588–597. https://doi.org/10.1002/cncr.29783
35.Carter BZ, Mak PY, Mak DH, Shi Y, Qiu Y, Bogenberger JM, Mu H, Tibes R, Yao H, Coombes KR, Jacamo RO, McQueen T, Kornblau SM, Andreeff M (2014) Synergistic targeting of AML stem/progenitor cells with IAP antagonist birinapant and dem- ethylating agents. J Natl Cancer Inst. https://doi.org/10.1093/
jnci/djt440
36.Steinhart L, Belz K, Fulda S (2013) Smac mimetic and demeth- ylating agents synergistically trigger cell death in acute myeloid leukemia cells and overcome apoptosis resistance by inducing necroptosis. Cell Death Dis 4:e802. https://doi.org/10.1038/cddis
.2013.320
37.Chromik J, Safferthal C, Serve H, Fulda S (2014) Smac mimetic primes apoptosis-resistant acute myeloid leukaemia cells for cyt- arabine-induced cell death by triggering necroptosis. Cancer Lett 344(1):101–109. https://doi.org/10.1016/j.canlet.2013.10.018
38.Thibault B, Genre L, Le Naour A, Broca C, Mery E, Vuagniaux G, Delord JP, Wiedemann N, Couderc B (2018) DEBIO 1143, an IAP inhibitor, reverses carboplatin resistance in ovarian can- cer cells and triggers apoptotic or necroptotic cell death. Sci Rep 8(1):17862. https://doi.org/10.1038/s41598-018-35860-z
39.Shekhar TM, Burvenich IJG, Harris MA, Rigopoulos A, Zanker D, Spurling A, Parker BS, Walkley CR, Scott AM, Hawkins CJ (2019) Smac mimetics LCL161 and GDC-0152 inhibit osteosar- coma growth and metastasis in mice. BMC Cancer 19(1):924. https://doi.org/10.1186/s12885-019-6103-5
40.Shekhar TM, Miles MA, Gupte A, Taylor S, Tascone B, Walkley CR, Hawkins CJ (2016) IAP antagonists sensitize murine osteo- sarcoma cells to killing by TNFalpha. Oncotarget 7(23):33866– 33886. https://doi.org/10.18632/oncotarget.8980
41.Shekhar TM, Green MM, Rayner DM, Miles MA, Cutts SM, Hawkins CJ (2015) Inhibition of Bcl-2 or IAP proteins does not provoke mutations in surviving cells. Mutat Res 777:23–32. https ://doi.org/10.1016/j.mrfmmm.2015.04.005
42.Tchoghandjian A, Jennewein C, Eckhardt I, Rajalingam K, Fulda S (2013) Identification of non-canonical NF-kappaB signaling as a critical mediator of Smac mimetic-stimulated migration and invasion of glioblastoma cells. Cell Death Dis 4:e564. https://doi. org/10.1038/cddis.2013.70
43.Petersen SL, Wang L, Yalcin-Chin A, Li L, Peyton M, Minna J, Harran P, Wang X (2007) Autocrine TNFalpha signaling ren- ders human cancer cells susceptible to Smac-mimetic-induced apoptosis. Cancer Cell 12(5):445–456. https://doi.org/10.1016/j. ccr.2007.08.029
44.Vince JE, Wong WW, Khan N, Feltham R, Chau D, Ahmed AU, Benetatos CA, Chunduru SK, Condon SM, McKinlay M, Brink R, Leverkus M, Tergaonkar V, Schneider P, Callus BA, Koentgen F, Vaux DL, Silke J (2007) IAP antagonists target cIAP1 to induce TNFalpha-dependent apoptosis. Cell 131(4):682–693. https://doi. org/10.1016/j.cell.2007.10.037

45.Miles MA, Hawkins CJ (2018) Mutagenic assessment of chemo- therapy and Smac mimetic drugs in cells with defective DNA damage response pathways. Sci Rep 8(1):14421–14421. https://
doi.org/10.1038/s41598-018-32517-9
46.DiPersio JF, Erba HP, Larson RA, Luger SM, Tallman MS, Brill JM, Vuagniaux G, Rouits E, Sorensen JM, Zanna C (2015) Oral Debio1143 (AT406), an antagonist of inhibitor of apoptosis pro- teins, combined with daunorubicin and cytarabine in patients with poor-risk acute myeloid leukemi—results of a phase I dose-esca- lation study. Clin Lymphoma Myeloma Leukem 15(7):443–449. https://doi.org/10.1016/j.clml.2015.02.020
47.Langdon CG, Wiedemann N, Held MA, Mamillapalli R, Iyi- dogan P, Theodosakis N, Platt JT, Levy F, Vuagniaux G, Wang S, Bosenberg MW, Stern DF (2015) SMAC mimetic Debio 1143 synergizes with taxanes, topoisomerase inhibitors and bromodo- main inhibitors to impede growth of lung adenocarcinoma cells. Oncotarget 6(35):37410–37425. https://doi.org/10.18632/oncot arget.6138
48.Zhang S, Li G, Zhao Y, Liu G, Wang Y, Ma X, Li D, Wu Y, Lu J (2012) Smac mimetic SM-164 potentiates APO2L/TRAIL- and doxorubicin-mediated anticancer activity in human hepatocellular carcinoma cells. PLoS ONE 7(12):e51461–e51461. https://doi. org/10.1371/journal.pone.0051461
49.Tchoghandjian A, Soubéran A, Tabouret E, Colin C, Denicolaï E, Jiguet-Jiglaire C, El-Battari A, Villard C, Baeza-Kallee N, Fig- arella-Branger D (2016) Inhibitor of apoptosis protein expression in glioblastomas and their in vitro and in vivo targeting by SMAC mimetic GDC-0152. Cell Death Dis 7(8):e2325–e2325. https://
doi.org/10.1038/cddis.2016.214
50.Tian A, Wilson GS, Lie S, Wu G, Hu Z, Hebbard L, Duan W, George J, Qiao L (2014) Synergistic effects of IAP inhibitor LCL161 and paclitaxel on hepatocellular carcinoma cells. Cancer Lett 351(2):232–241. https://doi.org/10.1016/j.canlet.2014.06.006
51.Yang C, Wang H, Zhang B, Chen Y, Zhang Y, Sun X, Xiao G, Nan K, Ren H, Qin S (2016) LCL161 increases paclitaxel-induced apoptosis by degrading cIAP1 and cIAP2 in NSCLC. J Exp Clin Cancer Res 35(1):158–158. https://doi.org/10.1186/s1304 6-016-0435-7
52.Kamata E, Kawamoto T, Ueha T, Hara H, Fukase N, Minoda M, Morishita M, Takemori T, Fujiwara S, Nishida K, Kuroda R, Kurosaka M, Akisue T (2017) Synergistic effects of a Smac mimetic with doxorubicin against human osteosarcoma. Antican- cer Res 37(11):6097–6106
53.Bagnjuk K, Kast VJ, Tiefenbacher A, Kaseder M, Yanase T, Burges A, Kunz L, Mayr D, Mayerhofer A (2019) Inhibitor of apoptosis proteins are potential targets for treatment of granulosa cell tumors—implications from studies in KGN. J Ovarian Res 12(1):76–76. https://doi.org/10.1186/s13048-019-0549-6
54.Tanzer MC, Matti I, Hildebrand JM, Young SN, Wardak A, Tripaydonis A, Petrie EJ, Mildenhall AL, Vaux DL, Vince JE, Czabotar PE, Silke J, Murphy JM (2016) Evolutionary divergence of the necroptosis effector MLKL. Cell Death Differ 23(7):1185– 1197. https://doi.org/10.1038/cdd.2015.169
55.McCabe KE, Bacos K, Lu D, Delaney JR, Axelrod J, Potter MD, Vamos M, Wong V, Cosford NDP, Xiang R, Stupack DG (2014) Triggering necroptosis in cisplatin and IAP antagonist-resistant ovarian carcinoma. Cell Death Dis 5(10):e1496–e1496. https://
doi.org/10.1038/cddis.2014.448
56.Tummers B, Green DR (2017) Caspase-8: regulating life and death. Immunol Rev 277(1):76–89. https://doi.org/10.1111/
imr.12541
57.Bloomer DT, Kitevska-Ilioski T, Pantaki-Eimany D, Ji Y, Miles MA, Heras B, Hawkins CJ (2019) CrmA orthologs from diverse poxviruses potently inhibit caspases-1 and -8, yet cleavage site mutagenesis frequently produces caspase-1-specific variants. Bio- chem J. https://doi.org/10.1042/bcj20190202
58.Zhou Q, Snipas S, Orth K, Muzio M, Dixit VM, Salvesen GS (1997) Target protease specificity of the viral serpin CrmA— analysis of five caspases. J Biol Chem 272(12):7797–7800
59.Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F (2015) Cleavage of GSDMD by inflam- matory caspases determines pyroptotic cell death. Nature 526(7575):660–665. https://doi.org/10.1038/nature15514
60.Gaither A, Porter D, Yao Y, Borawski J, Yang G, Donovan J, Sage D, Slisz J, Tran M, Straub C, Ramsey T, Iourgenko V, Huang A, Chen Y, Schlegel R, Labow M, Fawell S, Sellers WR, Zawel L (2007) A Smac mimetic rescue screen reveals roles for inhibitor of apoptosis proteins in tumor necrosis factor-alpha signaling. Can Res 67(24):11493–11498
61.Gradzka S, Thomas OS, Kretz O, Haimovici A, Vasilikos L, Wong WW-L, Häcker G, Gentle IE (2018) Inhibitor of apop- tosis proteins are required for effective fusion of autophago- somes with lysosomes. Cell Death Dis 9(5):529–529. https://
doi.org/10.1038/s41419-018-0508-y
62.Ding R, Wang X, Chen W, Li Z, Wei AL, Wang QB, Nie AH, Wang LL (2019) WX20120108, a novel IAP antagonist, induces tumor cell autophagy via activating ROS-FOXO pathway. Acta Pharmacol Sin. https://doi.org/10.1038/s41401-019-0253-5
63.Li B-X, Wang H-B, Qiu M-Z, Luo Q-Y, Yi H-J, Yan X-L, Pan W-T, Yuan L-P, Zhang Y-X, Xu J-H, Zhang L, Yang D-J (2018) Novel smac mimetic APG-1387 elicits ovarian cancer cell kill- ing through TNF-alpha, ripoptosome and autophagy mediated cell death pathway. J Exp Clin Cancer Res 37(1):53. https://doi. org/10.1186/s13046-018-0703-9
64.Véquaud E, Séveno C, Loussouarn D, Engelhart L, Campone M, Juin P, Barillé-Nion S (2015) YM155 potently triggers cell death in breast cancer cells through an autophagy-NF-kB net- work. Oncotarget 6:15
65.Peiqi L, Rong H, Hongming D, Zhuogang L, Wei J, Miao M (2018) GDC-0152-induced autophagy promotes apoptosis in HL-60 cells. Mol Cell Biochem 445(1):135–143. https://doi. org/10.1007/s11010-017-3259-7
66.Tanida I, Ueno T, Kominami E (2008) LC3 and autophagy. Methods Mol Biol (Clifton, NJ) 445:77–88. https ://doi. org/10.1007/978-1-59745-157-4_4
67.Mauvezin C, Neufeld TP (2015) Bafilomycin A1 disrupts autophagic flux by inhibiting both V-ATPase-dependent acidi- fication and Ca-P60A/SERCA-dependent autophagosome- lysosome fusion. Autophagy 11(8):1437–1438. https://doi. org/10.1080/15548627.2015.1066957
68.Schenk B, Fulda S (2015) Reactive oxygen species regulate Smac mimetic/TNFalpha-induced necroptotic signaling and cell death. Oncogene 34(47):5796–5806. https://doi.org/10.1038/
onc.2015.35
69.Dachert J, Schoeneberger H, Rohde K, Fulda S (2016) RSL3 and Erastin differentially regulate redox signaling to promote Smac mimetic-induced cell death. Oncotarget 7(39):63779–63792. https://doi.org/10.18632/oncotarget.11687
70.Florean C, Song S, Dicato M, Diederich M (2019) Redox biol- ogy of regulated cell death in cancer: a focus on necroptosis and ferroptosis. Free Radical Biol Med 134:177–189. https://
doi.org/10.1016/j.freeradbiomed.2019.01.008
71.Haß C, Belz K, Schoeneberger H, Fulda S (2016) Sensitiza- tion of acute lymphoblastic leukemia cells for LCL161-induced cell death by targeting redox homeostasis. Biochem Pharmacol 105:14–22. https://doi.org/10.1016/j.bcp.2016.01.004
72.Hagenbuchner J, Oberacher H, Arnhard K, Kiechl-Kohlendor- fer U, Ausserlechner MJ (2019) Modulation of respiration and mitochondrial dynamics by SMAC-mimetics for combination therapy in chemoresistant cancer. Theranostics 9(17):4909– 4922. https://doi.org/10.7150/thno.33758

73.Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, Patel DN, Bauer AJ, Cantley AM, Yang WS, Mor- rison B 3rd, Stockwell BR (2012) Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149(5):1060–1072. https://
doi.org/10.1016/j.cell.2012.03.042
74.Miotto G, Rossetto M, Di Paolo ML, Orian L, Venerando R, Rov- eri A, Vučković A-M, Bosello Travain V, Zaccarin M, Zennaro L, Maiorino M, Toppo S, Ursini F, Cozza G (2020) Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. Redox Biol 28:101328. https://doi.org/10.1016/j.redox.2019.101328
75.Kerksick C, Willoughby D (2005) The antioxidant role of glu- tathione and N-acetyl-cysteine supplements and exercise-induced oxidative stress. J Int Soc Sports Nutr 2(2):38–44. https://doi. org/10.1186/1550-2783-2-2-38
76.Song Z, Yao X, Wu M (2003) Direct interaction between sur- vivin and Smac/DIABLO is essential for the anti-apoptotic activity of survivin during taxol-induced apoptosis. J Biol Chem 278(25):23130–23140. https://doi.org/10.1074/jbc.M300957200
77.Rauch A, Hennig D, Schafer C, Wirth M, Marx C, Heinzel T, Schneider G (1845) Kramer OH (2014) Survivin and YM155: how faithful is the liaison? Biochem Biophys Acta 2:202–220. https://doi.org/10.1016/j.bbcan.2014.01.003
78.Falkenhorst J, Grunewald S, Mühlenberg T, Marino-Enriquez A, Reis A-C, Corless C, Heinrich M, Treckmann J, Podleska LE, Schuler M, Fletcher JA, Bauer S (2016) Inhibitor of apop- tosis proteins (IAPs) are commonly dysregulated in GIST and can be pharmacologically targeted to enhance the pro-apoptotic activity of imatinib. Oncotarget 7(27):41390–41403. https://doi. org/10.18632/oncotarget.9159
79.Frank D, Vaux DL, Murphy JM, Vince JE, Lindqvist LM (2019) Activated MLKL attenuates autophagy following its translocation to intracellular membranes. J Cell Sci. https://doi.org/10.1242/
jcs.220996
80.Denton D, Kumar S (2019) Autophagy-dependent cell death. Cell Death Differ 26(4):605–616. https://doi.org/10.1038/s4141 8-018-0252-y
81.Zhou B, Liu J, Kang R, Klionsky DJ, Kroemer G, Tang D (2019) Ferroptosis is a type of autophagy-dependent cell death. Semin Cancer Biol. https://doi.org/10.1016/j.semcancer.2019.03.002
82.Dächert J, Schoeneberger H, Rohde K, Fulda S (2016) RSL3 and Erastin differentially regulate redox signaling to promote Smac mimetic-induced cell death. Oncotarget 7(39):63779–63792. https ://doi.org/10.18632/oncotarget.11687
83.Vince JE, Wong WW, Gentle I, Lawlor KE, Allam R, O’Reilly L, Mason K, Gross O, Ma S, Guarda G, Anderton H, Castillo R, Hacker G, Silke J, Tschopp J (2012) Inhibitor of apoptosis proteins limit RIP3 kinase-dependent interleukin-1 activation. Immunity 36(2):215–227. https://doi.org/10.1016/j.immuni.2012.01.012
84.Munoz D, Brucoli M, Zecchini S, Sandoval-Hernandez A, Arbo- leda G, Lopez-Vallejo F, Delgado W, Giovarelli M, Coazzoli M, Catalani E, De Palma C, Perrotta C, Cuca L, Clementi E, Cervia D (2019) XIAP as a target of new small organic natural mol- ecules inducing human cancer cell death. Cancers. https://doi. org/10.3390/cancers11091336
85.Burgener SS, Leborgne NGF, Snipas SJ, Salvesen GS, Bird PI, Benarafa C (2019) Cathepsin G inhibition by serpinb1 and serpinb6 prevents programmed necrosis in neutrophils and monocytes and reduces GSDMD-driven inflammation. Cell Rep 27(12):3646–3656.e3645. https://doi.org/10.1016/j.celre p.2019.05.065
86.Laforge M, Silvestre R, Rodrigues V, Garibal J, Campillo-Gime- nez L, Mouhamad S, Monceaux V, Cumont MC, Rabezanahary H, Pruvost A, Cordeiro-da-Silva A, Hurtrel B, Silvestri G, Senik A, Estaquier J (2018) The anti-caspase inhibitor Q-VD-OPH prevents AIDS disease progression in SIV-infected rhesus macaques. J Clin Investig 128(4):1627–1640. https://doi.org/10.1172/jci95127
87.Lee DW, Faubel S, Edelstein CL (2015) A pan caspase inhibi- tor decreases caspase-1, IL-1alpha and IL-1beta, and protects against necrosis of cisplatin-treated freshly isolated proximal tubules. Ren Fail 37(1):144–150. https://doi.org/10.3109/08860 22x.2014.970194
88.Sollberger G, Strittmatter GE, Garstkiewicz M, Sand J, Beer HD (2014) Caspase-1: the inflammasome and beyond. Innate immu- nity 20(2):115–125. https://doi.org/10.1177/1753425913484374
89.Poon IK, Baxter AA, Lay FT, Mills GD, Adda CG, Payne JA, Phan TK, Ryan GF, White JA, Veneer PK, van der Weerden NL, Anderson MA, Kvansakul M, Hulett MD (2014) Phosphoi- nositide-mediated oligomerization of a defensin induces cell lysis. eLife. https://doi.org/10.7554/eLife.01808
90.Kessel D (2019) Apoptosis, paraptosis and autophagy: death and survival pathways associated with photodynamic therapy. Photochem Photobiol 95(1):119–125. https://doi.org/10.1111/
php.12952
91.Miles MA, Hawkins CJ (2017) Executioner caspases and CAD are essential for mutagenesis induced by TRAIL or vincristine. Cell Death Dis 8(10):e3062. https://doi.org/10.1038/cddis.2017.454
92.Aubrey BJ, Kelly GL, Kueh AJ, Brennan MS, O’Connor L, Milla L, Wilcox S, Tai L, Strasser A, Herold MJ (2015) An inducible

lentiviral guide RNA platform enables the identification of tumor- essential genes and tumor-promoting mutations in vivo. Cell Rep 10(8):1422–1432
93.Hawkins CJ, Uren AG, Hacker G, Medcalf RL, Vaux DL (1996) Inhibition of interleukin 1-beta-converting enzyme-mediated apoptosis of mammalian cells by baculovirus IAP. Proc Natl Acad Sci USA 93(24):13786–13790
94.Ashley DM, Riffkin CD, Lovric MM, Mikeska T, Dobrovic A, Maxwell JA, Friedman HS, Drummond KJ, Kaye AH, Gan HK, Johns TG, Hawkins CJ (2008) In vitro sensitivity testing of minimally passaged and uncultured gliomas with TRAIL and/
or chemotherapy drugs. Br J Cancer 99(2):294–304. https://doi. org/10.1038/sj.bjc.6604459
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.