The purpose of this study was to investigate the variability in MC1R and their possible association with the coat color in Chinese sheep breeds.2. Material and Methods2.1. AnimalsA total of 373 blood samples were collected from 10 Chinese sheep breeds representing a range of distinct coat colors (Figure 1). Breed name, inhibitor Bosutinib sample size, coat color phenotype, and sampling location for each breed were shown in Table 1. Coat colors were determined by direct visual inspection. Genomic DNA was extracted from blood specimens by using the TIANamp blood DNA kit (Tianjin, Beijing, China).Table 1Sample collection: breed name, sample size, coat color phenotype, and sampling location.2.2. SNPs Identification and GenotypingSNPs were identified by sequencing amplicons of the whole coding domain sequences (CDS, 954bp) and parts of the 5��- and 3��-untranslated regions (35 and 125bp, resp.

) of MC1R in both directions. Three DNA pools comprise thirty individuals with 10 individuals DNA (100ng/��L, 5��L for each individual) from each breed of Large-tailed Han sheep (White), Minxian Black-fur sheep (Black), and Kazakh Fat-Rumped sheep (Brown) and were used for identification mutation sites. Primers (MF: GAGAGCAAGCACCCTTTCCT, MR: GAGAGTCCTGTGATTCCCCT) for MC1R amplification and sequencing were designed with the program Primer 3 (http://fokker.wi.mit.

edu/) based on the published coding region sequences in sheep (GenBank accession number: “type”:”entrez-nucleotide”,”attrs”:”text”:”Y13965″,”term_id”:”2463320″,”term_text”:”Y13965″Y13965) and the complete sequences in bovine and goat which include 5��- and 3��-untranslated flanking regions (GenBank accession numbers: “type”:”entrez-nucleotide”,”attrs”:”text”:”AF445641″,”term_id”:”17298538″,”term_text”:”AF445641″AF445641 and “type”:”entrez-nucleotide”,”attrs”:”text”:”FM212940″,”term_id”:”249690994″,”term_text”:”FM212940″FM212940). All amplifications were performed on Eppendorf Mastercycler (Hamburg, Germany). The reaction was performed in a total of 25��L containing 50ng DNA template (DNA pools), 100��M dNTPs, 10pM of MC1R specific primers (MF and MR), and 2.5U Taq polymerase (Bocai, Shanghai, China). After denaturation at 94��C for 3min, 35 amplification cycles were performed comprising a denaturation step at 94��C GSK-3 for 30s and an annealing step at 62��C for 30s, an extension at 72��C for 45s, followed by a last extension at 72��C for 10min. The PCR products were separated and visualized by electrophoresis on 1.