On the basis of the establishment of the optimal PCR and reverse transcription (RT)-PCR for the detection of a single virus, a quadruplex RT-PCR method that employed virus-specific primers was developed for the simultaneous detection and
differentiation of all the four viruses in banana. Several sets of primers for each target virus were evaluated for their sensitivity and specificity by simplex and quadruplex RT-PCR. The assay was then validated using banana samples infected with one or more viruses collected from fields and tissue-culture banana industries in Hainan Island. “
“Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. p38 kinase assay All the 40 isolates used in the study were pathogenic
when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate IWR-1 mw BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. Rucaparib One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers,
URP-2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana. “
“Cucurbit yellow stunting disorder virus (CYSDV) (genus, Crinivirus: family, Closteroviridae) is an emerging plant pathogen, transmitted by the sweet potato whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), which infects cucurbit crops causing significant economic losses.